Incidental Mutation 'R1224:Zfp52'
ID152849
Institutional Source Beutler Lab
Gene Symbol Zfp52
Ensembl Gene ENSMUSG00000051341
Gene Namezinc finger protein 52
SynonymsKRAB11, Zfp-52, zfec29, Zfp76
MMRRC Submission 039293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R1224 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location21555046-21562066 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21555062 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 6 (V6A)
Ref Sequence ENSEMBL: ENSMUSP00000078233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079242
AA Change: V6A

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078233
Gene: ENSMUSG00000051341
AA Change: V6A

DomainStartEndE-ValueType
KRAB 13 73 3.79e-24 SMART
ZnF_C2H2 186 208 1.79e-2 SMART
ZnF_C2H2 214 236 5.07e0 SMART
ZnF_C2H2 242 264 2.29e1 SMART
ZnF_C2H2 270 292 2.36e-2 SMART
ZnF_C2H2 298 320 4.72e-2 SMART
ZnF_C2H2 326 348 1.77e1 SMART
ZnF_C2H2 382 404 1.12e-3 SMART
ZnF_C2H2 410 432 1.34e2 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
ZnF_C2H2 466 488 6.99e-5 SMART
ZnF_C2H2 494 516 4.17e-3 SMART
ZnF_C2H2 522 544 5.5e-3 SMART
ZnF_C2H2 550 572 8.47e-4 SMART
ZnF_C2H2 578 600 1.01e-1 SMART
ZnF_C2H2 606 628 9.73e-4 SMART
ZnF_C2H2 634 656 4.17e-3 SMART
ZnF_C2H2 662 684 6.32e-3 SMART
ZnF_C2H2 690 712 1.69e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,178,385 C207S probably benign Het
Abca8a T A 11: 110,040,582 E1248D probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aldh16a1 T C 7: 45,142,047 probably null Het
Aldh9a1 T A 1: 167,352,658 I107N probably damaging Het
Atp6ap1l G A 13: 90,886,556 Q236* probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd46 A T 1: 195,062,398 I344K possibly damaging Het
Ces3a A T 8: 105,051,509 D204V probably damaging Het
Clstn3 T C 6: 124,457,919 S346G probably benign Het
Dock1 A G 7: 135,108,819 D1190G possibly damaging Het
Gimap8 G A 6: 48,650,695 S201N probably benign Het
Gm10153 A G 7: 142,190,335 S19P unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Kcng3 A G 17: 83,631,395 L75P probably damaging Het
Krt31 C T 11: 100,049,864 probably null Het
Ly6a A G 15: 74,996,478 V54A possibly damaging Het
Map3k7cl T A 16: 87,556,003 D21E probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Rapsn T C 2: 91,043,198 L230P probably damaging Het
Rhog C A 7: 102,239,752 V165F possibly damaging Het
Slc44a4 T C 17: 34,921,868 V313A probably benign Het
Sox14 G C 9: 99,875,115 H190Q probably damaging Het
Sval2 G A 6: 41,864,254 D103N probably benign Het
Tm9sf3 A T 19: 41,223,195 V403D probably damaging Het
Tmem269 T C 4: 119,217,126 K18R probably benign Het
Unc80 T C 1: 66,471,980 F49S probably damaging Het
Zdhhc7 T A 8: 120,082,572 T299S probably benign Het
Other mutations in Zfp52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Zfp52 APN 17 21560150 missense probably benign 0.12
PIT4449001:Zfp52 UTSW 17 21557216 missense probably damaging 1.00
R0270:Zfp52 UTSW 17 21561302 missense probably damaging 1.00
R0674:Zfp52 UTSW 17 21561846 missense probably damaging 1.00
R1248:Zfp52 UTSW 17 21560049 missense probably damaging 1.00
R1622:Zfp52 UTSW 17 21561571 missense probably benign 0.00
R1663:Zfp52 UTSW 17 21561822 missense possibly damaging 0.59
R1917:Zfp52 UTSW 17 21560164 missense probably benign
R4272:Zfp52 UTSW 17 21560197 nonsense probably null
R4273:Zfp52 UTSW 17 21560197 nonsense probably null
R4278:Zfp52 UTSW 17 21561870 missense probably benign
R4683:Zfp52 UTSW 17 21561507 missense probably benign 0.31
R4865:Zfp52 UTSW 17 21561243 missense probably damaging 1.00
R4964:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R4966:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R5430:Zfp52 UTSW 17 21555067 missense probably benign 0.01
R5685:Zfp52 UTSW 17 21561751 missense probably benign 0.15
R6133:Zfp52 UTSW 17 21560471 missense probably damaging 1.00
R6882:Zfp52 UTSW 17 21555047 start codon destroyed probably null 1.00
R7083:Zfp52 UTSW 17 21560130 missense possibly damaging 0.86
R7439:Zfp52 UTSW 17 21560870 nonsense probably null
R7456:Zfp52 UTSW 17 21561353 missense probably damaging 1.00
R7740:Zfp52 UTSW 17 21560990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGTCATTGACCAGAGTCGAGG -3'
(R):5'- AGGCATGGAGTGCTGACATTCAAAG -3'

Sequencing Primer
(F):5'- GACCAGAGTCGAGGTTTTTTTC -3'
(R):5'- TGAGTCCAAGCCCAAGTGTATG -3'
Posted On2014-01-29