Incidental Mutation 'R1224:Kcng3'
ID152851
Institutional Source Beutler Lab
Gene Symbol Kcng3
Ensembl Gene ENSMUSG00000045053
Gene Namepotassium voltage-gated channel, subfamily G, member 3
SynonymsKv10.1a, Kv10.1b, KV6.3
MMRRC Submission 039293-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1224 (G1)
Quality Score174
Status Not validated
Chromosome17
Chromosomal Location83585957-83631895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83631395 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 75 (L75P)
Ref Sequence ENSEMBL: ENSMUSP00000054910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051482]
Predicted Effect probably damaging
Transcript: ENSMUST00000051482
AA Change: L75P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054910
Gene: ENSMUSG00000045053
AA Change: L75P

DomainStartEndE-ValueType
BTB 9 119 5.2e-5 SMART
Pfam:Ion_trans 167 417 4.6e-42 PFAM
Pfam:Ion_trans_2 321 411 4.3e-13 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,178,385 C207S probably benign Het
Abca8a T A 11: 110,040,582 E1248D probably damaging Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Aldh16a1 T C 7: 45,142,047 probably null Het
Aldh9a1 T A 1: 167,352,658 I107N probably damaging Het
Atp6ap1l G A 13: 90,886,556 Q236* probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd46 A T 1: 195,062,398 I344K possibly damaging Het
Ces3a A T 8: 105,051,509 D204V probably damaging Het
Clstn3 T C 6: 124,457,919 S346G probably benign Het
Dock1 A G 7: 135,108,819 D1190G possibly damaging Het
Gimap8 G A 6: 48,650,695 S201N probably benign Het
Gm10153 A G 7: 142,190,335 S19P unknown Het
Igfn1 A G 1: 135,969,756 V1024A probably benign Het
Krt31 C T 11: 100,049,864 probably null Het
Ly6a A G 15: 74,996,478 V54A possibly damaging Het
Map3k7cl T A 16: 87,556,003 D21E probably benign Het
Olfr1537 G C 9: 39,238,251 P58A probably benign Het
Rapsn T C 2: 91,043,198 L230P probably damaging Het
Rhog C A 7: 102,239,752 V165F possibly damaging Het
Slc44a4 T C 17: 34,921,868 V313A probably benign Het
Sox14 G C 9: 99,875,115 H190Q probably damaging Het
Sval2 G A 6: 41,864,254 D103N probably benign Het
Tm9sf3 A T 19: 41,223,195 V403D probably damaging Het
Tmem269 T C 4: 119,217,126 K18R probably benign Het
Unc80 T C 1: 66,471,980 F49S probably damaging Het
Zdhhc7 T A 8: 120,082,572 T299S probably benign Het
Zfp52 T C 17: 21,555,062 V6A possibly damaging Het
Other mutations in Kcng3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Kcng3 APN 17 83587850 missense probably damaging 1.00
PIT4403001:Kcng3 UTSW 17 83588182 missense probably damaging 1.00
R0034:Kcng3 UTSW 17 83588383 splice site probably benign
R0056:Kcng3 UTSW 17 83587756 missense probably damaging 0.98
R0335:Kcng3 UTSW 17 83587737 missense possibly damaging 0.51
R1462:Kcng3 UTSW 17 83631063 missense probably damaging 0.96
R1601:Kcng3 UTSW 17 83588339 missense probably damaging 1.00
R3147:Kcng3 UTSW 17 83588320 missense possibly damaging 0.71
R4854:Kcng3 UTSW 17 83588306 missense probably damaging 0.97
R5408:Kcng3 UTSW 17 83631005 missense probably benign 0.12
R5719:Kcng3 UTSW 17 83631134 missense possibly damaging 0.71
R5791:Kcng3 UTSW 17 83588210 missense probably benign 0.02
R6155:Kcng3 UTSW 17 83588378 missense probably benign
R6437:Kcng3 UTSW 17 83631129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCTGCTCCGGTCATCCAGACTGC -3'
(R):5'- AGCTGCTCAAGGACTTCCCGCT -3'

Sequencing Primer
(F):5'- GTTGTCAGCAACCGCCG -3'
(R):5'- AACGAGTACTTCTTCGACCG -3'
Posted On2014-01-29