Incidental Mutation 'R1225:Slc46a2'
ID152861
Institutional Source Beutler Lab
Gene Symbol Slc46a2
Ensembl Gene ENSMUSG00000028386
Gene Namesolute carrier family 46, member 2
SynonymsLy110, TSO-1C12, 5430429N04Rik, Tscot
MMRRC Submission 039294-MU
Accession Numbers

Genbank: NM_021053

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1225 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59905126-59915056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59914125 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 266 (V266E)
Ref Sequence ENSEMBL: ENSMUSP00000030081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030081]
Predicted Effect probably benign
Transcript: ENSMUST00000030081
AA Change: V266E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000030081
Gene: ENSMUSG00000028386
AA Change: V266E

DomainStartEndE-ValueType
Pfam:MFS_1 65 424 1.1e-16 PFAM
transmembrane domain 438 460 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: About one-third of homozygotes carrying a reporter allele that results in a small deletion within exon 1 display a slight reduction in total thymocyte yield at 6 weeks of age. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,254,839 probably benign Het
A730013G03Rik T A 1: 192,833,645 noncoding transcript Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ahnak T A 19: 9,002,883 D510E probably damaging Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Arid1a A G 4: 133,687,365 V1185A unknown Het
Atp2c2 C A 8: 119,735,245 Q286K probably damaging Het
Blzf1 T C 1: 164,299,596 E209G probably damaging Het
Bmp6 A G 13: 38,346,281 T117A probably benign Het
Cmip T C 8: 117,445,371 F394L probably damaging Het
Col6a3 T A 1: 90,811,516 D330V probably damaging Het
Crebbp A T 16: 4,126,956 S491R probably benign Het
Dedd G A 1: 171,340,295 probably null Het
Dennd4a A G 9: 64,911,675 H1704R probably benign Het
Dicer1 C T 12: 104,691,607 V1903I probably damaging Het
Dnah9 A G 11: 65,871,060 V3868A possibly damaging Het
Eif5b A G 1: 38,037,628 I674V probably damaging Het
F13a1 T C 13: 37,025,851 N47D probably benign Het
Fancd2 T C 6: 113,535,861 S53P probably damaging Het
Fsip1 C A 2: 118,248,350 L170F probably damaging Het
Git2 A T 5: 114,733,178 probably benign Het
Gm9742 T C 13: 8,029,839 noncoding transcript Het
Heatr4 C T 12: 83,978,046 E334K probably benign Het
Hoga1 T G 19: 42,070,189 V110G probably damaging Het
Ighv6-4 T A 12: 114,406,550 D75V probably damaging Het
Med15 G T 16: 17,722,788 S31R probably damaging Het
Nbeal2 T C 9: 110,632,886 E1467G probably damaging Het
Olfr201 T C 16: 59,269,224 T148A probably benign Het
Olfr705 A T 7: 106,714,524 D52E probably benign Het
Olfr720 T A 14: 14,175,600 I161F possibly damaging Het
Papss1 T C 3: 131,579,301 probably benign Het
Pde4d A T 13: 109,950,221 M610L probably benign Het
Prickle4 T G 17: 47,688,689 probably null Het
Sema3g A G 14: 31,220,679 Y79C probably damaging Het
Setbp1 T A 18: 78,858,208 D748V probably damaging Het
Slc9a8 T C 2: 167,471,523 I435T probably benign Het
Snx29 T C 16: 11,420,686 probably benign Het
Son C T 16: 91,657,340 R992C probably damaging Het
Stxbp5 T C 10: 9,812,391 N389D possibly damaging Het
Vmn1r28 C T 6: 58,265,966 Q265* probably null Het
Other mutations in Slc46a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc46a2 APN 4 59911926 nonsense probably null
G5030:Slc46a2 UTSW 4 59913867 missense probably damaging 1.00
R0008:Slc46a2 UTSW 4 59914544 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R0047:Slc46a2 UTSW 4 59914392 missense probably damaging 1.00
R1199:Slc46a2 UTSW 4 59914189 missense probably benign 0.17
R1389:Slc46a2 UTSW 4 59914620 missense probably damaging 1.00
R1965:Slc46a2 UTSW 4 59914249 missense probably damaging 1.00
R2334:Slc46a2 UTSW 4 59914150 missense possibly damaging 0.94
R4036:Slc46a2 UTSW 4 59913818 missense probably damaging 1.00
R4230:Slc46a2 UTSW 4 59914048 missense probably benign 0.15
R4600:Slc46a2 UTSW 4 59911886 missense probably damaging 1.00
R5851:Slc46a2 UTSW 4 59913906 missense probably damaging 1.00
R6467:Slc46a2 UTSW 4 59914077 missense probably benign 0.00
R7213:Slc46a2 UTSW 4 59914279 missense possibly damaging 0.71
R7536:Slc46a2 UTSW 4 59914141 nonsense probably null
R7986:Slc46a2 UTSW 4 59911858 missense probably benign 0.11
R8377:Slc46a2 UTSW 4 59914713 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAACTGGGACTCCTAGACCAC -3'
(R):5'- AGCAAATCGTTGGGCACTCTGC -3'

Sequencing Primer
(F):5'- TGAAGATTATGTACCCAGAAGCC -3'
(R):5'- TTAACTGCCTGCAGCGTT -3'
Posted On2014-01-29