Incidental Mutation 'R1225:Fancd2'
ID 152865
Institutional Source Beutler Lab
Gene Symbol Fancd2
Ensembl Gene ENSMUSG00000034023
Gene Name Fanconi anemia, complementation group D2
Synonyms 2410150O07Rik
MMRRC Submission 039294-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1225 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 113531682-113597017 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113535861 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 53 (S53P)
Ref Sequence ENSEMBL: ENSMUSP00000144928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032425] [ENSMUST00000036340] [ENSMUST00000204827]
AlphaFold Q80V62
Predicted Effect probably benign
Transcript: ENSMUST00000032425
SMART Domains Protein: ENSMUSP00000032425
Gene: ENSMUSG00000030286

DomainStartEndE-ValueType
Pfam:DUF106 5 191 6.2e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000036340
AA Change: S53P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: S53P

DomainStartEndE-ValueType
Pfam:FancD2 1 1415 N/A PFAM
low complexity region 1430 1450 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000101051
SMART Domains Protein: ENSMUSP00000098612
Gene: ENSMUSG00000034023

DomainStartEndE-ValueType
Pfam:FancD2 1 129 1.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203526
Predicted Effect probably damaging
Transcript: ENSMUST00000204827
AA Change: S53P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: S53P

DomainStartEndE-ValueType
Pfam:FancD2 1 1402 N/A PFAM
low complexity region 1417 1437 N/A INTRINSIC
Meta Mutation Damage Score 0.3399 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,254,839 probably benign Het
A730013G03Rik T A 1: 192,833,645 noncoding transcript Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ahnak T A 19: 9,002,883 D510E probably damaging Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Arid1a A G 4: 133,687,365 V1185A unknown Het
Atp2c2 C A 8: 119,735,245 Q286K probably damaging Het
Blzf1 T C 1: 164,299,596 E209G probably damaging Het
Bmp6 A G 13: 38,346,281 T117A probably benign Het
Cmip T C 8: 117,445,371 F394L probably damaging Het
Col6a3 T A 1: 90,811,516 D330V probably damaging Het
Crebbp A T 16: 4,126,956 S491R probably benign Het
Dedd G A 1: 171,340,295 probably null Het
Dennd4a A G 9: 64,911,675 H1704R probably benign Het
Dicer1 C T 12: 104,691,607 V1903I probably damaging Het
Dnah9 A G 11: 65,871,060 V3868A possibly damaging Het
Eif5b A G 1: 38,037,628 I674V probably damaging Het
F13a1 T C 13: 37,025,851 N47D probably benign Het
Fsip1 C A 2: 118,248,350 L170F probably damaging Het
Git2 A T 5: 114,733,178 probably benign Het
Gm9742 T C 13: 8,029,839 noncoding transcript Het
Heatr4 C T 12: 83,978,046 E334K probably benign Het
Hoga1 T G 19: 42,070,189 V110G probably damaging Het
Ighv6-4 T A 12: 114,406,550 D75V probably damaging Het
Med15 G T 16: 17,722,788 S31R probably damaging Het
Nbeal2 T C 9: 110,632,886 E1467G probably damaging Het
Olfr201 T C 16: 59,269,224 T148A probably benign Het
Olfr705 A T 7: 106,714,524 D52E probably benign Het
Olfr720 T A 14: 14,175,600 I161F possibly damaging Het
Papss1 T C 3: 131,579,301 probably benign Het
Pde4d A T 13: 109,950,221 M610L probably benign Het
Prickle4 T G 17: 47,688,689 probably null Het
Sema3g A G 14: 31,220,679 Y79C probably damaging Het
Setbp1 T A 18: 78,858,208 D748V probably damaging Het
Slc46a2 A T 4: 59,914,125 V266E probably benign Het
Slc9a8 T C 2: 167,471,523 I435T probably benign Het
Snx29 T C 16: 11,420,686 probably benign Het
Son C T 16: 91,657,340 R992C probably damaging Het
Stxbp5 T C 10: 9,812,391 N389D possibly damaging Het
Vmn1r28 C T 6: 58,265,966 Q265* probably null Het
Other mutations in Fancd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Fancd2 APN 6 113564396 critical splice donor site probably null
IGL00475:Fancd2 APN 6 113568610 missense probably benign 0.01
IGL01319:Fancd2 APN 6 113584899 missense probably damaging 0.98
IGL01339:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01373:Fancd2 APN 6 113553752 missense probably benign 0.00
IGL01393:Fancd2 APN 6 113577360 splice site probably benign
IGL01630:Fancd2 APN 6 113563124 missense probably damaging 1.00
IGL01769:Fancd2 APN 6 113545111 missense possibly damaging 0.90
IGL01882:Fancd2 APN 6 113546640 missense probably benign 0.05
IGL02029:Fancd2 APN 6 113570975 missense probably benign 0.44
IGL02224:Fancd2 APN 6 113568320 critical splice donor site probably null
IGL02271:Fancd2 APN 6 113535759 splice site probably benign
IGL02352:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02359:Fancd2 APN 6 113563112 missense probably damaging 1.00
IGL02427:Fancd2 APN 6 113549352 splice site probably null
IGL02512:Fancd2 APN 6 113570943 missense probably damaging 1.00
IGL02530:Fancd2 APN 6 113562461 missense probably damaging 1.00
IGL02801:Fancd2 APN 6 113593317 missense probably benign 0.00
IGL03090:Fancd2 APN 6 113537597 splice site probably null
IGL03247:Fancd2 APN 6 113568208 missense probably benign 0.03
R0278:Fancd2 UTSW 6 113548448 critical splice donor site probably null
R0401:Fancd2 UTSW 6 113548343 missense possibly damaging 0.46
R0420:Fancd2 UTSW 6 113536979 missense probably damaging 0.98
R0496:Fancd2 UTSW 6 113555130 splice site probably benign
R0762:Fancd2 UTSW 6 113574658 missense probably benign 0.20
R0827:Fancd2 UTSW 6 113586249 critical splice donor site probably null
R1576:Fancd2 UTSW 6 113578405 missense probably damaging 0.98
R2010:Fancd2 UTSW 6 113593291 missense probably damaging 0.96
R2079:Fancd2 UTSW 6 113555187 missense probably damaging 1.00
R2118:Fancd2 UTSW 6 113560074 splice site probably benign
R2141:Fancd2 UTSW 6 113549321 missense probably benign 0.00
R2168:Fancd2 UTSW 6 113591159 missense possibly damaging 0.92
R2180:Fancd2 UTSW 6 113574637 missense probably benign 0.33
R3016:Fancd2 UTSW 6 113536726 missense probably benign 0.00
R3153:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3154:Fancd2 UTSW 6 113593269 missense possibly damaging 0.55
R3783:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3786:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R3787:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R4379:Fancd2 UTSW 6 113561716 missense probably benign 0.00
R4388:Fancd2 UTSW 6 113556368 missense probably damaging 0.99
R4544:Fancd2 UTSW 6 113572642 critical splice acceptor site probably null
R4598:Fancd2 UTSW 6 113585477 missense probably benign 0.06
R4832:Fancd2 UTSW 6 113553722 missense probably benign 0.16
R4841:Fancd2 UTSW 6 113562430 missense probably damaging 1.00
R4922:Fancd2 UTSW 6 113585473 missense probably benign 0.03
R5375:Fancd2 UTSW 6 113568712 missense possibly damaging 0.93
R5579:Fancd2 UTSW 6 113560051 critical splice acceptor site probably null
R5782:Fancd2 UTSW 6 113548872 missense probably benign 0.00
R5871:Fancd2 UTSW 6 113556282 missense probably benign 0.30
R5901:Fancd2 UTSW 6 113549365 missense probably damaging 1.00
R5909:Fancd2 UTSW 6 113561711 missense probably benign
R6026:Fancd2 UTSW 6 113551770 missense possibly damaging 0.46
R6166:Fancd2 UTSW 6 113555251 missense possibly damaging 0.67
R6393:Fancd2 UTSW 6 113578413 missense probably benign 0.01
R6666:Fancd2 UTSW 6 113585509 missense probably damaging 0.96
R6669:Fancd2 UTSW 6 113593327 missense probably benign 0.00
R6676:Fancd2 UTSW 6 113537665 nonsense probably null
R6762:Fancd2 UTSW 6 113586016 splice site probably null
R6911:Fancd2 UTSW 6 113548385 missense probably damaging 0.98
R6992:Fancd2 UTSW 6 113571018 critical splice donor site probably null
R7091:Fancd2 UTSW 6 113545101 missense probably damaging 1.00
R7252:Fancd2 UTSW 6 113556285 missense probably damaging 0.98
R7343:Fancd2 UTSW 6 113536939 missense probably benign 0.01
R7344:Fancd2 UTSW 6 113568709 missense probably benign 0.09
R7354:Fancd2 UTSW 6 113595946 missense unknown
R7489:Fancd2 UTSW 6 113564304 missense probably benign
R7501:Fancd2 UTSW 6 113548403 missense possibly damaging 0.95
R7504:Fancd2 UTSW 6 113545038 missense probably damaging 1.00
R7992:Fancd2 UTSW 6 113565204 missense probably damaging 1.00
R8027:Fancd2 UTSW 6 113546622 missense probably damaging 1.00
R8487:Fancd2 UTSW 6 113568226 missense probably damaging 1.00
R8509:Fancd2 UTSW 6 113572570 missense probably benign 0.00
R8757:Fancd2 UTSW 6 113560093 missense possibly damaging 0.91
R8960:Fancd2 UTSW 6 113563168 critical splice donor site probably null
R8978:Fancd2 UTSW 6 113585546 splice site probably benign
R9110:Fancd2 UTSW 6 113535801 missense possibly damaging 0.94
R9116:Fancd2 UTSW 6 113555219 missense probably benign 0.00
R9490:Fancd2 UTSW 6 113578455 missense probably damaging 0.98
R9667:Fancd2 UTSW 6 113553756 nonsense probably null
Z1088:Fancd2 UTSW 6 113581422 missense probably benign 0.00
Z1177:Fancd2 UTSW 6 113545025 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTCAGGAACACAGCAGATGGC -3'
(R):5'- TCATAAGCAGTTTCTACAGAGCGGC -3'

Sequencing Primer
(F):5'- ATGGCCTCTCAGAACATTTGGAC -3'
(R):5'- TTCTACAGAGCGGCCTCAC -3'
Posted On 2014-01-29