Mutagenetix > Incidental Mutation

Incidental Mutation 'R1225:Atp2c2'

152868

Institutional Source

Beutler Lab

Gene Symbol

Atp2c2

Ensembl Gene

ENSMUSG00000034112

Gene Name

ATPase, Ca++ transporting, type 2C, member 2

Synonyms

MMRRC Submission

039294-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119700009-119757717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 119735245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 286 (Q286K)

Ref Sequence

ENSEMBL: ENSMUSP00000092794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095171] [ENSMUST00000212454]

AlphaFold

A7L9Z8

Predicted Effect

probably damaging
Transcript: ENSMUST00000095171
AA Change: Q286K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092794
Gene: ENSMUSG00000034112
AA Change: Q286K

Domain	Start	End	E-Value	Type
Cation_ATPase_N	54	128	1.27e-12	SMART
Pfam:E1-E2_ATPase	133	366	1.7e-62	PFAM
Pfam:Hydrolase	371	684	5.3e-18	PFAM
Pfam:HAD	374	681	7.4e-11	PFAM
Pfam:Cation_ATPase	437	521	1.1e-17	PFAM
Pfam:Cation_ATPase_C	754	927	1.1e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212454

Meta Mutation Damage Score

0.4116

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

100% (43/43)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	A	T	9: 103,254,839		probably benign	Het
A730013G03Rik	T	A	1: 192,833,645		noncoding transcript	Het
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Ahnak	T	A	19: 9,002,883	D510E	probably damaging	Het
Angptl4	C	T	17: 33,781,191	A68T	possibly damaging	Het
Arid1a	A	G	4: 133,687,365	V1185A	unknown	Het
Blzf1	T	C	1: 164,299,596	E209G	probably damaging	Het
Bmp6	A	G	13: 38,346,281	T117A	probably benign	Het
Cmip	T	C	8: 117,445,371	F394L	probably damaging	Het
Col6a3	T	A	1: 90,811,516	D330V	probably damaging	Het
Crebbp	A	T	16: 4,126,956	S491R	probably benign	Het
Dedd	G	A	1: 171,340,295		probably null	Het
Dennd4a	A	G	9: 64,911,675	H1704R	probably benign	Het
Dicer1	C	T	12: 104,691,607	V1903I	probably damaging	Het
Dnah9	A	G	11: 65,871,060	V3868A	possibly damaging	Het
Eif5b	A	G	1: 38,037,628	I674V	probably damaging	Het
F13a1	T	C	13: 37,025,851	N47D	probably benign	Het
Fancd2	T	C	6: 113,535,861	S53P	probably damaging	Het
Fsip1	C	A	2: 118,248,350	L170F	probably damaging	Het
Git2	A	T	5: 114,733,178		probably benign	Het
Gm9742	T	C	13: 8,029,839		noncoding transcript	Het
Heatr4	C	T	12: 83,978,046	E334K	probably benign	Het
Hoga1	T	G	19: 42,070,189	V110G	probably damaging	Het
Ighv6-4	T	A	12: 114,406,550	D75V	probably damaging	Het
Med15	G	T	16: 17,722,788	S31R	probably damaging	Het
Nbeal2	T	C	9: 110,632,886	E1467G	probably damaging	Het
Olfr201	T	C	16: 59,269,224	T148A	probably benign	Het
Olfr705	A	T	7: 106,714,524	D52E	probably benign	Het
Olfr720	T	A	14: 14,175,600	I161F	possibly damaging	Het
Papss1	T	C	3: 131,579,301		probably benign	Het
Pde4d	A	T	13: 109,950,221	M610L	probably benign	Het
Prickle4	T	G	17: 47,688,689		probably null	Het
Sema3g	A	G	14: 31,220,679	Y79C	probably damaging	Het
Setbp1	T	A	18: 78,858,208	D748V	probably damaging	Het
Slc46a2	A	T	4: 59,914,125	V266E	probably benign	Het
Slc9a8	T	C	2: 167,471,523	I435T	probably benign	Het
Snx29	T	C	16: 11,420,686		probably benign	Het
Son	C	T	16: 91,657,340	R992C	probably damaging	Het
Stxbp5	T	C	10: 9,812,391	N389D	possibly damaging	Het
Vmn1r28	C	T	6: 58,265,966	Q265*	probably null	Het

Other mutations in Atp2c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00966:Atp2c2	APN	8	119745590	missense	probably benign
IGL01624:Atp2c2	APN	8	119757450	missense	probably benign	0.00
IGL02133:Atp2c2	APN	8	119754335	missense	probably benign	0.00
IGL02221:Atp2c2	APN	8	119744334	missense	probably damaging	1.00
IGL02606:Atp2c2	APN	8	119730274	missense	probably benign
IGL02657:Atp2c2	APN	8	119753032	missense	probably damaging	1.00
IGL02839:Atp2c2	APN	8	119749120	missense	possibly damaging	0.85
IGL03122:Atp2c2	APN	8	119742675	missense	possibly damaging	0.77
R0031:Atp2c2	UTSW	8	119749062	missense	probably benign	0.15
R0372:Atp2c2	UTSW	8	119757441	missense	probably benign
R0502:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0503:Atp2c2	UTSW	8	119734577	missense	probably null	0.99
R0584:Atp2c2	UTSW	8	119738418	missense	probably benign	0.01
R1580:Atp2c2	UTSW	8	119752987	missense	probably benign	0.00
R1620:Atp2c2	UTSW	8	119749126	missense	probably benign
R1638:Atp2c2	UTSW	8	119756003	missense	possibly damaging	0.82
R1745:Atp2c2	UTSW	8	119725094	missense	probably benign	0.02
R1746:Atp2c2	UTSW	8	119734443	unclassified	probably benign
R1907:Atp2c2	UTSW	8	119749876	splice site	probably benign
R2104:Atp2c2	UTSW	8	119749845	missense	probably benign
R2151:Atp2c2	UTSW	8	119756102	missense	probably benign
R2152:Atp2c2	UTSW	8	119756102	missense	probably benign
R2154:Atp2c2	UTSW	8	119756102	missense	probably benign
R2207:Atp2c2	UTSW	8	119748309	missense	probably damaging	1.00
R3874:Atp2c2	UTSW	8	119735296	missense	possibly damaging	0.74
R3912:Atp2c2	UTSW	8	119721276	missense	probably damaging	1.00
R4093:Atp2c2	UTSW	8	119749871	critical splice donor site	probably null
R4782:Atp2c2	UTSW	8	119749152	missense	probably damaging	0.97
R4801:Atp2c2	UTSW	8	119747687	missense	probably damaging	1.00
R4973:Atp2c2	UTSW	8	119754263	missense	probably benign	0.00
R5485:Atp2c2	UTSW	8	119753062	critical splice donor site	probably null
R5978:Atp2c2	UTSW	8	119749875	splice site	probably null
R6377:Atp2c2	UTSW	8	119726354	missense	probably benign	0.10
R6613:Atp2c2	UTSW	8	119756021	missense	probably damaging	0.99
R6765:Atp2c2	UTSW	8	119753017	missense	probably damaging	1.00
R6836:Atp2c2	UTSW	8	119734415	missense	probably damaging	1.00
R6963:Atp2c2	UTSW	8	119730267	nonsense	probably null
R7220:Atp2c2	UTSW	8	119745561	missense	probably benign	0.00
R7238:Atp2c2	UTSW	8	119742421	missense	possibly damaging	0.73
R7373:Atp2c2	UTSW	8	119730252	missense	probably benign	0.02
R7438:Atp2c2	UTSW	8	119748197	missense	probably damaging	1.00
R7573:Atp2c2	UTSW	8	119751269	missense	probably damaging	1.00
R7677:Atp2c2	UTSW	8	119748176	missense	probably benign	0.00
R7737:Atp2c2	UTSW	8	119742395	missense	probably damaging	1.00
R7912:Atp2c2	UTSW	8	119730178	missense	possibly damaging	0.81
R8821:Atp2c2	UTSW	8	119749294	splice site	probably null
R8831:Atp2c2	UTSW	8	119749294	splice site	probably null
R9200:Atp2c2	UTSW	8	119748260	nonsense	probably null
R9211:Atp2c2	UTSW	8	119719293	missense	probably benign
R9246:Atp2c2	UTSW	8	119730250	missense	probably damaging	1.00
R9285:Atp2c2	UTSW	8	119738402	missense	probably benign	0.00
RF004:Atp2c2	UTSW	8	119752822	missense	probably damaging	1.00
RF012:Atp2c2	UTSW	8	119745514	missense	possibly damaging	0.91
Z1177:Atp2c2	UTSW	8	119734385	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAATTCCATGTGTGCCTTGACACC -3'
(R):5'- CCAAAGAGGAGACCCCAATTTCAAGTG -3'

Sequencing Primer
(F):5'- GTGCCTTGACACCCCCAC -3'
(R):5'- aggtggtgttggggagg -3'

Posted On

2014-01-29