Incidental Mutation 'R1225:Stxbp5'
ID 152873
Institutional Source Beutler Lab
Gene Symbol Stxbp5
Ensembl Gene ENSMUSG00000019790
Gene Name syntaxin binding protein 5 (tomosyn)
Synonyms LGL3, tomosyn 1, 0710001E20Rik, 4930565N16Rik
MMRRC Submission 039294-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1225 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 9631291-9776823 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9688135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 389 (N389D)
Ref Sequence ENSEMBL: ENSMUSP00000121507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038213] [ENSMUST00000125200] [ENSMUST00000141722]
AlphaFold Q8K400
Predicted Effect possibly damaging
Transcript: ENSMUST00000038213
AA Change: N389D

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044535
Gene: ENSMUSG00000019790
AA Change: N389D

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 276 385 2e-36 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
Pfam:Lgl_C 771 1050 2.7e-8 PFAM
PDB:1URQ|A 1086 1145 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000125200
AA Change: N389D

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121507
Gene: ENSMUSG00000019790
AA Change: N389D

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.6e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 722 730 N/A INTRINSIC
Pfam:Lgl_C 839 994 1.9e-8 PFAM
PDB:1URQ|A 1033 1092 2e-33 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000141722
AA Change: N389D

PolyPhen 2 Score 0.486 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123253
Gene: ENSMUSG00000019790
AA Change: N389D

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
WD40 46 86 2.21e1 SMART
WD40 88 127 5.94e0 SMART
WD40 132 171 1.97e2 SMART
WD40 185 225 1.99e0 SMART
WD40 228 266 5.69e-4 SMART
Pfam:LLGL 273 385 1.7e-46 PFAM
WD40 386 465 2.88e-1 SMART
WD40 491 530 3.68e1 SMART
low complexity region 572 591 N/A INTRINSIC
low complexity region 739 747 N/A INTRINSIC
Pfam:Lgl_C 856 1011 2e-8 PFAM
PDB:1URQ|A 1050 1109 2e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219200
Meta Mutation Damage Score 0.1748 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntaxin 1 is a component of the 7S and 20S SNARE complexes which are involved in docking and fusion of synaptic vesicles with the presynaptic plasma membrane. This gene encodes a syntaxin 1 binding protein. In rat, a similar protein dissociates syntaxin 1 from the Munc18/n-Sec1/rbSec1 complex to form a 10S complex, an intermediate which can be converted to the 7S SNARE complex. Thus this protein is thought to be involved in neurotransmitter release by stimulating SNARE complex formation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some background sensitive prenatal lethality and increased synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730013G03Rik T A 1: 192,515,953 (GRCm39) noncoding transcript Het
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Ahnak T A 19: 8,980,247 (GRCm39) D510E probably damaging Het
Angptl4 C T 17: 34,000,165 (GRCm39) A68T possibly damaging Het
Arid1a A G 4: 133,414,676 (GRCm39) V1185A unknown Het
Atp2c2 C A 8: 120,461,984 (GRCm39) Q286K probably damaging Het
Blzf1 T C 1: 164,127,165 (GRCm39) E209G probably damaging Het
Bmp6 A G 13: 38,530,257 (GRCm39) T117A probably benign Het
Cmip T C 8: 118,172,110 (GRCm39) F394L probably damaging Het
Col6a3 T A 1: 90,739,238 (GRCm39) D330V probably damaging Het
Crebbp A T 16: 3,944,820 (GRCm39) S491R probably benign Het
Dedd G A 1: 171,167,863 (GRCm39) probably null Het
Dennd4a A G 9: 64,818,957 (GRCm39) H1704R probably benign Het
Dicer1 C T 12: 104,657,866 (GRCm39) V1903I probably damaging Het
Dnah9 A G 11: 65,761,886 (GRCm39) V3868A possibly damaging Het
Eif5b A G 1: 38,076,709 (GRCm39) I674V probably damaging Het
F13a1 T C 13: 37,209,825 (GRCm39) N47D probably benign Het
Fancd2 T C 6: 113,512,822 (GRCm39) S53P probably damaging Het
Fsip1 C A 2: 118,078,831 (GRCm39) L170F probably damaging Het
Git2 A T 5: 114,871,239 (GRCm39) probably benign Het
Gm9742 T C 13: 8,079,875 (GRCm39) noncoding transcript Het
Heatr4 C T 12: 84,024,820 (GRCm39) E334K probably benign Het
Hoga1 T G 19: 42,058,628 (GRCm39) V110G probably damaging Het
Ighv6-4 T A 12: 114,370,170 (GRCm39) D75V probably damaging Het
Inhca A T 9: 103,132,038 (GRCm39) probably benign Het
Med15 G T 16: 17,540,652 (GRCm39) S31R probably damaging Het
Nbeal2 T C 9: 110,461,954 (GRCm39) E1467G probably damaging Het
Or2ag1 A T 7: 106,313,731 (GRCm39) D52E probably benign Het
Or2t6 T A 14: 14,175,600 (GRCm38) I161F possibly damaging Het
Or5ac19 T C 16: 59,089,587 (GRCm39) T148A probably benign Het
Papss1 T C 3: 131,285,062 (GRCm39) probably benign Het
Pde4d A T 13: 110,086,755 (GRCm39) M610L probably benign Het
Prickle4 T G 17: 47,999,614 (GRCm39) probably null Het
Sema3g A G 14: 30,942,636 (GRCm39) Y79C probably damaging Het
Setbp1 T A 18: 78,901,423 (GRCm39) D748V probably damaging Het
Slc46a2 A T 4: 59,914,125 (GRCm39) V266E probably benign Het
Slc9a8 T C 2: 167,313,443 (GRCm39) I435T probably benign Het
Snx29 T C 16: 11,238,550 (GRCm39) probably benign Het
Son C T 16: 91,454,228 (GRCm39) R992C probably damaging Het
Vmn1r28 C T 6: 58,242,951 (GRCm39) Q265* probably null Het
Other mutations in Stxbp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Stxbp5 APN 10 9,675,694 (GRCm39) missense probably damaging 1.00
IGL00950:Stxbp5 APN 10 9,684,346 (GRCm39) splice site probably benign
IGL01725:Stxbp5 APN 10 9,693,155 (GRCm39) missense probably damaging 1.00
IGL02150:Stxbp5 APN 10 9,638,565 (GRCm39) missense probably damaging 1.00
IGL02339:Stxbp5 APN 10 9,692,041 (GRCm39) missense possibly damaging 0.89
IGL02697:Stxbp5 APN 10 9,638,700 (GRCm39) nonsense probably null
IGL02720:Stxbp5 APN 10 9,665,105 (GRCm39) critical splice donor site probably null
IGL03155:Stxbp5 APN 10 9,692,034 (GRCm39) missense probably null 1.00
IGL03288:Stxbp5 APN 10 9,742,447 (GRCm39) splice site probably null
Fatty_fish UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
reindeer UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
H8562:Stxbp5 UTSW 10 9,645,187 (GRCm39) missense probably benign 0.36
PIT4544001:Stxbp5 UTSW 10 9,693,048 (GRCm39) critical splice donor site probably null
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0025:Stxbp5 UTSW 10 9,638,492 (GRCm39) missense probably damaging 1.00
R0219:Stxbp5 UTSW 10 9,646,272 (GRCm39) missense probably benign 0.36
R0226:Stxbp5 UTSW 10 9,742,442 (GRCm39) splice site probably benign
R0631:Stxbp5 UTSW 10 9,660,102 (GRCm39) missense probably benign
R0723:Stxbp5 UTSW 10 9,644,617 (GRCm39) missense probably damaging 1.00
R0833:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0836:Stxbp5 UTSW 10 9,740,843 (GRCm39) missense probably damaging 1.00
R0863:Stxbp5 UTSW 10 9,684,784 (GRCm39) missense possibly damaging 0.86
R1271:Stxbp5 UTSW 10 9,692,013 (GRCm39) missense probably damaging 1.00
R1536:Stxbp5 UTSW 10 9,713,836 (GRCm39) missense probably damaging 1.00
R1852:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1884:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1902:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1917:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R1918:Stxbp5 UTSW 10 9,688,042 (GRCm39) missense possibly damaging 0.94
R2174:Stxbp5 UTSW 10 9,711,590 (GRCm39) missense possibly damaging 0.69
R3773:Stxbp5 UTSW 10 9,644,671 (GRCm39) missense probably damaging 1.00
R3901:Stxbp5 UTSW 10 9,645,163 (GRCm39) missense probably damaging 1.00
R3981:Stxbp5 UTSW 10 9,665,060 (GRCm39) intron probably benign
R4572:Stxbp5 UTSW 10 9,713,888 (GRCm39) missense probably damaging 0.99
R4764:Stxbp5 UTSW 10 9,646,367 (GRCm39) missense probably damaging 1.00
R4841:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4842:Stxbp5 UTSW 10 9,638,635 (GRCm39) missense probably benign 0.06
R4884:Stxbp5 UTSW 10 9,688,085 (GRCm39) nonsense probably null
R4887:Stxbp5 UTSW 10 9,684,844 (GRCm39) missense probably benign
R4930:Stxbp5 UTSW 10 9,636,610 (GRCm39) utr 3 prime probably benign
R5065:Stxbp5 UTSW 10 9,646,295 (GRCm39) missense probably damaging 1.00
R5285:Stxbp5 UTSW 10 9,674,019 (GRCm39) critical splice acceptor site probably null
R5306:Stxbp5 UTSW 10 9,675,735 (GRCm39) missense probably damaging 1.00
R5455:Stxbp5 UTSW 10 9,684,252 (GRCm39) missense probably benign
R5531:Stxbp5 UTSW 10 9,638,668 (GRCm39) nonsense probably null
R5605:Stxbp5 UTSW 10 9,645,490 (GRCm39) intron probably benign
R5614:Stxbp5 UTSW 10 9,636,638 (GRCm39) utr 3 prime probably benign
R5805:Stxbp5 UTSW 10 9,776,330 (GRCm39) missense probably benign
R5990:Stxbp5 UTSW 10 9,711,677 (GRCm39) missense probably damaging 1.00
R6025:Stxbp5 UTSW 10 9,675,772 (GRCm39) missense probably benign 0.00
R6056:Stxbp5 UTSW 10 9,646,430 (GRCm39) missense probably benign 0.00
R6147:Stxbp5 UTSW 10 9,684,216 (GRCm39) missense possibly damaging 0.93
R6194:Stxbp5 UTSW 10 9,693,083 (GRCm39) missense probably damaging 0.99
R6284:Stxbp5 UTSW 10 9,642,931 (GRCm39) missense probably damaging 1.00
R6284:Stxbp5 UTSW 10 9,642,923 (GRCm39) missense probably benign 0.32
R6394:Stxbp5 UTSW 10 9,774,975 (GRCm39) nonsense probably null
R6427:Stxbp5 UTSW 10 9,774,998 (GRCm39) missense probably damaging 1.00
R6894:Stxbp5 UTSW 10 9,660,105 (GRCm39) missense probably benign 0.00
R7229:Stxbp5 UTSW 10 9,673,931 (GRCm39) missense probably damaging 1.00
R7337:Stxbp5 UTSW 10 9,684,874 (GRCm39) missense possibly damaging 0.93
R7686:Stxbp5 UTSW 10 9,645,154 (GRCm39) missense probably damaging 0.99
R7811:Stxbp5 UTSW 10 9,684,248 (GRCm39) missense probably benign
R7974:Stxbp5 UTSW 10 9,646,439 (GRCm39) splice site probably null
R8009:Stxbp5 UTSW 10 9,692,046 (GRCm39) missense probably damaging 1.00
R8287:Stxbp5 UTSW 10 9,660,129 (GRCm39) missense probably benign
R8353:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8360:Stxbp5 UTSW 10 9,688,003 (GRCm39) critical splice donor site probably null
R8453:Stxbp5 UTSW 10 9,684,792 (GRCm39) missense probably benign 0.30
R8487:Stxbp5 UTSW 10 9,688,033 (GRCm39) missense possibly damaging 0.80
R8548:Stxbp5 UTSW 10 9,693,050 (GRCm39) missense probably null 0.98
R8805:Stxbp5 UTSW 10 9,713,859 (GRCm39) nonsense probably null
R9172:Stxbp5 UTSW 10 9,645,152 (GRCm39) missense possibly damaging 0.94
R9472:Stxbp5 UTSW 10 9,719,101 (GRCm39) missense probably damaging 1.00
R9513:Stxbp5 UTSW 10 9,687,754 (GRCm39) missense probably benign 0.17
R9649:Stxbp5 UTSW 10 9,774,938 (GRCm39) missense probably damaging 0.96
X0020:Stxbp5 UTSW 10 9,638,634 (GRCm39) missense possibly damaging 0.47
Z1176:Stxbp5 UTSW 10 9,776,289 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGGGTAACTTTGAGCACCCAAGCC -3'
(R):5'- GCTTCAGCTACTTTCTAGCCCACATGG -3'

Sequencing Primer
(F):5'- TGTTATCAACACCTCAAGGAGAC -3'
(R):5'- TGTGTAGCACGCAACCTTG -3'
Posted On 2014-01-29