Incidental Mutation 'R1225:Pde4d'
ID152880
Institutional Source Beutler Lab
Gene Symbol Pde4d
Ensembl Gene ENSMUSG00000021699
Gene Namephosphodiesterase 4D, cAMP specific
Synonymsdunce, Dpde3, 9630011N22Rik
MMRRC Submission 039294-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1225 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location108449948-109953461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109950221 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 610 (M610L)
Ref Sequence ENSEMBL: ENSMUSP00000112991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074103] [ENSMUST00000079975] [ENSMUST00000117420] [ENSMUST00000117879] [ENSMUST00000119507] [ENSMUST00000119672] [ENSMUST00000120664] [ENSMUST00000120671] [ENSMUST00000122041] [ENSMUST00000135275] [ENSMUST00000177907]
Predicted Effect probably benign
Transcript: ENSMUST00000074103
AA Change: M485L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073742
Gene: ENSMUSG00000021699
AA Change: M485L

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
HDc 329 504 1.12e-2 SMART
low complexity region 652 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079975
AA Change: M505L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078891
Gene: ENSMUSG00000021699
AA Change: M505L

DomainStartEndE-ValueType
HDc 349 524 1.12e-2 SMART
low complexity region 672 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117420
AA Change: M324L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113610
Gene: ENSMUSG00000021699
AA Change: M324L

DomainStartEndE-ValueType
HDc 168 343 1.12e-2 SMART
low complexity region 491 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117879
AA Change: M311L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112774
Gene: ENSMUSG00000021699
AA Change: M311L

DomainStartEndE-ValueType
HDc 155 330 1.12e-2 SMART
low complexity region 478 493 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119507
AA Change: M510L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000114089
Gene: ENSMUSG00000021699
AA Change: M510L

DomainStartEndE-ValueType
HDc 354 529 1.12e-2 SMART
low complexity region 677 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119672
Predicted Effect probably benign
Transcript: ENSMUST00000120664
AA Change: M391L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113024
Gene: ENSMUSG00000021699
AA Change: M391L

DomainStartEndE-ValueType
HDc 235 410 1.12e-2 SMART
low complexity region 558 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120671
AA Change: M610L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112991
Gene: ENSMUSG00000021699
AA Change: M610L

DomainStartEndE-ValueType
low complexity region 45 84 N/A INTRINSIC
HDc 454 629 1.12e-2 SMART
low complexity region 777 792 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122041
AA Change: M554L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: M554L

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135275
AA Change: M507L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119583
Gene: ENSMUSG00000021699
AA Change: M507L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
HDc 351 526 1.12e-2 SMART
low complexity region 674 689 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153234
AA Change: M560L
SMART Domains Protein: ENSMUSP00000121592
Gene: ENSMUSG00000021699
AA Change: M560L

DomainStartEndE-ValueType
PDB:1E9K|A 22 59 9e-18 PDB
low complexity region 69 85 N/A INTRINSIC
HDc 405 580 1.12e-2 SMART
low complexity region 728 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155459
SMART Domains Protein: ENSMUSP00000114945
Gene: ENSMUSG00000021699

DomainStartEndE-ValueType
Pfam:PDEase_I 121 189 2.6e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177907
AA Change: M554L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: M554L

DomainStartEndE-ValueType
HDc 398 573 1.12e-2 SMART
low complexity region 721 736 N/A INTRINSIC
Meta Mutation Damage Score 0.0731 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 100% (43/43)
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik A T 9: 103,254,839 probably benign Het
A730013G03Rik T A 1: 192,833,645 noncoding transcript Het
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Ahnak T A 19: 9,002,883 D510E probably damaging Het
Angptl4 C T 17: 33,781,191 A68T possibly damaging Het
Arid1a A G 4: 133,687,365 V1185A unknown Het
Atp2c2 C A 8: 119,735,245 Q286K probably damaging Het
Blzf1 T C 1: 164,299,596 E209G probably damaging Het
Bmp6 A G 13: 38,346,281 T117A probably benign Het
Cmip T C 8: 117,445,371 F394L probably damaging Het
Col6a3 T A 1: 90,811,516 D330V probably damaging Het
Crebbp A T 16: 4,126,956 S491R probably benign Het
Dedd G A 1: 171,340,295 probably null Het
Dennd4a A G 9: 64,911,675 H1704R probably benign Het
Dicer1 C T 12: 104,691,607 V1903I probably damaging Het
Dnah9 A G 11: 65,871,060 V3868A possibly damaging Het
Eif5b A G 1: 38,037,628 I674V probably damaging Het
F13a1 T C 13: 37,025,851 N47D probably benign Het
Fancd2 T C 6: 113,535,861 S53P probably damaging Het
Fsip1 C A 2: 118,248,350 L170F probably damaging Het
Git2 A T 5: 114,733,178 probably benign Het
Gm9742 T C 13: 8,029,839 noncoding transcript Het
Heatr4 C T 12: 83,978,046 E334K probably benign Het
Hoga1 T G 19: 42,070,189 V110G probably damaging Het
Ighv6-4 T A 12: 114,406,550 D75V probably damaging Het
Med15 G T 16: 17,722,788 S31R probably damaging Het
Nbeal2 T C 9: 110,632,886 E1467G probably damaging Het
Olfr201 T C 16: 59,269,224 T148A probably benign Het
Olfr705 A T 7: 106,714,524 D52E probably benign Het
Olfr720 T A 14: 14,175,600 I161F possibly damaging Het
Papss1 T C 3: 131,579,301 probably benign Het
Prickle4 T G 17: 47,688,689 probably null Het
Sema3g A G 14: 31,220,679 Y79C probably damaging Het
Setbp1 T A 18: 78,858,208 D748V probably damaging Het
Slc46a2 A T 4: 59,914,125 V266E probably benign Het
Slc9a8 T C 2: 167,471,523 I435T probably benign Het
Snx29 T C 16: 11,420,686 probably benign Het
Son C T 16: 91,657,340 R992C probably damaging Het
Stxbp5 T C 10: 9,812,391 N389D possibly damaging Het
Vmn1r28 C T 6: 58,265,966 Q265* probably null Het
Other mutations in Pde4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Pde4d APN 13 109936687 missense possibly damaging 0.69
IGL00792:Pde4d APN 13 109935395 missense possibly damaging 0.85
IGL01014:Pde4d APN 13 109949502 missense probably damaging 1.00
IGL01660:Pde4d APN 13 109938072 missense probably damaging 1.00
IGL02233:Pde4d APN 13 109740550 missense probably damaging 1.00
IGL02405:Pde4d APN 13 108860209 critical splice donor site probably null
IGL02544:Pde4d APN 13 109740523 missense probably damaging 1.00
IGL02885:Pde4d APN 13 109948261 missense probably damaging 1.00
IGL03286:Pde4d APN 13 109954506 unclassified probably benign
IGL03406:Pde4d APN 13 109954591 unclassified probably benign
Heliosphere UTSW 13 109116942 missense probably benign
Stubbs UTSW 13 109772722 intron probably benign
IGL03055:Pde4d UTSW 13 109935345 missense probably damaging 1.00
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0020:Pde4d UTSW 13 109954570 missense possibly damaging 0.66
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0054:Pde4d UTSW 13 109740421 missense probably benign 0.23
R0357:Pde4d UTSW 13 109951268 missense possibly damaging 0.46
R0482:Pde4d UTSW 13 109936710 missense probably benign 0.00
R0689:Pde4d UTSW 13 109740544 missense possibly damaging 0.78
R0884:Pde4d UTSW 13 109950940 missense probably damaging 0.99
R1169:Pde4d UTSW 13 109950928 splice site probably null
R1246:Pde4d UTSW 13 109950973 missense probably damaging 1.00
R1344:Pde4d UTSW 13 109950387 nonsense probably null
R1351:Pde4d UTSW 13 109951275 missense possibly damaging 0.46
R1371:Pde4d UTSW 13 109117061 missense probably benign 0.00
R1418:Pde4d UTSW 13 109950387 nonsense probably null
R2197:Pde4d UTSW 13 109948390 missense probably damaging 1.00
R2440:Pde4d UTSW 13 109927197 intron probably benign
R3114:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3115:Pde4d UTSW 13 109948258 missense probably damaging 1.00
R3722:Pde4d UTSW 13 109951332 nonsense probably null
R3742:Pde4d UTSW 13 109740479 missense probably benign 0.42
R3797:Pde4d UTSW 13 109632897 missense probably benign 0.29
R3983:Pde4d UTSW 13 109740406 missense probably benign 0.23
R4618:Pde4d UTSW 13 109933877 missense probably benign 0.13
R4768:Pde4d UTSW 13 109933874 missense probably damaging 1.00
R4795:Pde4d UTSW 13 109938171 intron probably benign
R4824:Pde4d UTSW 13 109116866 missense probably benign 0.00
R4942:Pde4d UTSW 13 108860199 missense probably benign 0.00
R4984:Pde4d UTSW 13 109740464 missense probably damaging 1.00
R5180:Pde4d UTSW 13 109740473 missense probably benign 0.13
R5267:Pde4d UTSW 13 109260809 intron probably benign
R5311:Pde4d UTSW 13 109632864 missense probably benign 0.02
R5311:Pde4d UTSW 13 109632865 missense probably benign
R5376:Pde4d UTSW 13 109772644 missense probably benign 0.00
R5551:Pde4d UTSW 13 109948396 critical splice donor site probably null
R5753:Pde4d UTSW 13 109772722 intron probably benign
R5754:Pde4d UTSW 13 109938013 missense probably damaging 0.98
R5838:Pde4d UTSW 13 109740442 missense probably damaging 0.99
R5864:Pde4d UTSW 13 109938048 missense probably benign 0.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6039:Pde4d UTSW 13 109948342 missense probably damaging 1.00
R6049:Pde4d UTSW 13 109032585 nonsense probably null
R6214:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6215:Pde4d UTSW 13 109949433 missense probably damaging 1.00
R6273:Pde4d UTSW 13 109950221 missense possibly damaging 0.94
R6431:Pde4d UTSW 13 109601786 unclassified probably null
R6501:Pde4d UTSW 13 109116942 missense probably benign
R6534:Pde4d UTSW 13 109632901 missense probably benign 0.05
R6709:Pde4d UTSW 13 109948279 missense probably damaging 1.00
R6722:Pde4d UTSW 13 109632898 nonsense probably null
R7164:Pde4d UTSW 13 109032688 missense probably benign
R7222:Pde4d UTSW 13 109757579 missense probably damaging 1.00
R7417:Pde4d UTSW 13 109632788 synonymous probably null
R7489:Pde4d UTSW 13 109116767 missense unknown
R7563:Pde4d UTSW 13 109951007 missense probably benign 0.37
R7861:Pde4d UTSW 13 109935324 missense probably damaging 0.99
R7944:Pde4d UTSW 13 109935324 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGACCATTTGAGCAGCTAGGAAC -3'
(R):5'- CGTTGTGCTTGTCACACATGGGAC -3'

Sequencing Primer
(F):5'- GTGCCTCTCAAGACAGTTAAATGC -3'
(R):5'- GCTTGTCACACATGGGACTTATC -3'
Posted On2014-01-29