Mutagenetix > Incidental Mutation

Incidental Mutation 'R1225:Son'

152887

Institutional Source

Beutler Lab

Gene Symbol

Son

Ensembl Gene

ENSMUSG00000022961

Gene Name

Son DNA binding protein

Synonyms

2900011L12Rik

MMRRC Submission

039294-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R1225 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

91444712-91476080 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 91454228 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 992 (R992C)

Ref Sequence

ENSEMBL: ENSMUSP00000122320 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114036] [ENSMUST00000114037] [ENSMUST00000117633] [ENSMUST00000119368] [ENSMUST00000122302] [ENSMUST00000140312]

AlphaFold

Q9QX47

Predicted Effect

probably damaging
Transcript: ENSMUST00000114036
AA Change: R992C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109670
Gene: ENSMUSG00000022961
AA Change: R992C

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.65e-7	PROSPERO
internal_repeat_2	214	362	6.55e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.65e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.55e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114037
AA Change: R992C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000109671
Gene: ENSMUSG00000022961
AA Change: R992C

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.71e-7	PROSPERO
internal_repeat_2	214	362	7.05e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.71e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	7.05e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC
G_patch	2321	2367	1.15e-17	SMART
Pfam:DND1_DSRM	2388	2442	5.7e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117633
AA Change: R992C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112453
Gene: ENSMUSG00000022961
AA Change: R992C

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	1.59e-7	PROSPERO
internal_repeat_2	214	362	6.63e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	1.59e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	6.63e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
Pfam:RSRP	1909	2216	1e-12	PFAM
G_patch	2321	2367	1.15e-17	SMART
DSRM	2390	2458	5.37e-20	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119368
AA Change: R992C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113129
Gene: ENSMUSG00000022961
AA Change: R992C

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.22e-7	PROSPERO
internal_repeat_2	214	362	8.67e-6	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.22e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	8.67e-6	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000122302

SMART Domains

Protein: ENSMUSP00000113615
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
low complexity region	104	115	N/A	INTRINSIC
low complexity region	159	165	N/A	INTRINSIC
G_patch	331	377	1.15e-17	SMART
Pfam:DND1_DSRM	398	452	7.9e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000140312
AA Change: R992C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122320
Gene: ENSMUSG00000022961
AA Change: R992C

Domain	Start	End	E-Value	Type
coiled coil region	106	132	N/A	INTRINSIC
internal_repeat_1	155	350	2.93e-7	PROSPERO
internal_repeat_2	214	362	1.1e-5	PROSPERO
low complexity region	391	403	N/A	INTRINSIC
low complexity region	459	469	N/A	INTRINSIC
internal_repeat_1	507	750	2.93e-7	PROSPERO
low complexity region	975	1021	N/A	INTRINSIC
low complexity region	1124	1135	N/A	INTRINSIC
low complexity region	1141	1172	N/A	INTRINSIC
internal_repeat_2	1208	1347	1.1e-5	PROSPERO
low complexity region	1354	1376	N/A	INTRINSIC
low complexity region	1386	1407	N/A	INTRINSIC
low complexity region	1805	1811	N/A	INTRINSIC
low complexity region	1838	2067	N/A	INTRINSIC
low complexity region	2080	2091	N/A	INTRINSIC
low complexity region	2094	2105	N/A	INTRINSIC
low complexity region	2149	2155	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147891

SMART Domains

Protein: ENSMUSP00000122544
Gene: ENSMUSG00000022961

Domain	Start	End	E-Value	Type
Pfam:RSRP	61	358	2.9e-13	PFAM
low complexity region	466	477	N/A	INTRINSIC

Meta Mutation Damage Score

0.3462

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

100% (43/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains multiple simple repeats. The encoded protein binds RNA and promotes pre-mRNA splicing, particularly of transcripts with poor splice sites. The protein also recognizes a specific DNA sequence found in the human hepatitis B virus (HBV) and represses HBV core promoter activity. There is a pseudogene for this gene on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730013G03Rik	T	A	1: 192,515,953 (GRCm39)		noncoding transcript	Het
Abcb10	C	T	8: 124,688,791 (GRCm39)	G495D	probably damaging	Het
Ahnak	T	A	19: 8,980,247 (GRCm39)	D510E	probably damaging	Het
Angptl4	C	T	17: 34,000,165 (GRCm39)	A68T	possibly damaging	Het
Arid1a	A	G	4: 133,414,676 (GRCm39)	V1185A	unknown	Het
Atp2c2	C	A	8: 120,461,984 (GRCm39)	Q286K	probably damaging	Het
Blzf1	T	C	1: 164,127,165 (GRCm39)	E209G	probably damaging	Het
Bmp6	A	G	13: 38,530,257 (GRCm39)	T117A	probably benign	Het
Cmip	T	C	8: 118,172,110 (GRCm39)	F394L	probably damaging	Het
Col6a3	T	A	1: 90,739,238 (GRCm39)	D330V	probably damaging	Het
Crebbp	A	T	16: 3,944,820 (GRCm39)	S491R	probably benign	Het
Dedd	G	A	1: 171,167,863 (GRCm39)		probably null	Het
Dennd4a	A	G	9: 64,818,957 (GRCm39)	H1704R	probably benign	Het
Dicer1	C	T	12: 104,657,866 (GRCm39)	V1903I	probably damaging	Het
Dnah9	A	G	11: 65,761,886 (GRCm39)	V3868A	possibly damaging	Het
Eif5b	A	G	1: 38,076,709 (GRCm39)	I674V	probably damaging	Het
F13a1	T	C	13: 37,209,825 (GRCm39)	N47D	probably benign	Het
Fancd2	T	C	6: 113,512,822 (GRCm39)	S53P	probably damaging	Het
Fsip1	C	A	2: 118,078,831 (GRCm39)	L170F	probably damaging	Het
Git2	A	T	5: 114,871,239 (GRCm39)		probably benign	Het
Gm9742	T	C	13: 8,079,875 (GRCm39)		noncoding transcript	Het
Heatr4	C	T	12: 84,024,820 (GRCm39)	E334K	probably benign	Het
Hoga1	T	G	19: 42,058,628 (GRCm39)	V110G	probably damaging	Het
Ighv6-4	T	A	12: 114,370,170 (GRCm39)	D75V	probably damaging	Het
Inhca	A	T	9: 103,132,038 (GRCm39)		probably benign	Het
Med15	G	T	16: 17,540,652 (GRCm39)	S31R	probably damaging	Het
Nbeal2	T	C	9: 110,461,954 (GRCm39)	E1467G	probably damaging	Het
Or2ag1	A	T	7: 106,313,731 (GRCm39)	D52E	probably benign	Het
Or2t6	T	A	14: 14,175,600 (GRCm38)	I161F	possibly damaging	Het
Or5ac19	T	C	16: 59,089,587 (GRCm39)	T148A	probably benign	Het
Papss1	T	C	3: 131,285,062 (GRCm39)		probably benign	Het
Pde4d	A	T	13: 110,086,755 (GRCm39)	M610L	probably benign	Het
Prickle4	T	G	17: 47,999,614 (GRCm39)		probably null	Het
Sema3g	A	G	14: 30,942,636 (GRCm39)	Y79C	probably damaging	Het
Setbp1	T	A	18: 78,901,423 (GRCm39)	D748V	probably damaging	Het
Slc46a2	A	T	4: 59,914,125 (GRCm39)	V266E	probably benign	Het
Slc9a8	T	C	2: 167,313,443 (GRCm39)	I435T	probably benign	Het
Snx29	T	C	16: 11,238,550 (GRCm39)		probably benign	Het
Stxbp5	T	C	10: 9,688,135 (GRCm39)	N389D	possibly damaging	Het
Vmn1r28	C	T	6: 58,242,951 (GRCm39)	Q265*	probably null	Het

Other mutations in Son

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00531:Son	APN	16	91,461,210 (GRCm39)	missense	probably damaging	0.99
IGL01024:Son	APN	16	91,452,798 (GRCm39)	missense	probably damaging	1.00
IGL01066:Son	APN	16	91,457,024 (GRCm39)	intron	probably benign
IGL01083:Son	APN	16	91,454,279 (GRCm39)	missense	probably damaging	1.00
IGL01115:Son	APN	16	91,456,346 (GRCm39)	missense	probably benign	0.31
IGL01467:Son	APN	16	91,454,165 (GRCm39)	missense	possibly damaging	0.93
IGL01506:Son	APN	16	91,454,174 (GRCm39)	missense	possibly damaging	0.67
IGL01933:Son	APN	16	91,454,903 (GRCm39)	missense	probably benign	0.00
IGL02156:Son	APN	16	91,452,992 (GRCm39)	missense	possibly damaging	0.93
IGL02473:Son	APN	16	91,455,683 (GRCm39)	missense	probably damaging	0.99
IGL02498:Son	APN	16	91,453,713 (GRCm39)	missense	probably damaging	0.99
IGL02517:Son	APN	16	91,452,099 (GRCm39)	missense	possibly damaging	0.92
IGL02530:Son	APN	16	91,455,359 (GRCm39)	missense	possibly damaging	0.50
IGL02865:Son	APN	16	91,448,640 (GRCm39)	missense	probably damaging	1.00
IGL03180:Son	APN	16	91,453,896 (GRCm39)	missense	probably damaging	1.00
R0013:Son	UTSW	16	91,448,550 (GRCm39)	missense	probably damaging	1.00
R0036:Son	UTSW	16	91,457,054 (GRCm39)	intron	probably benign
R0037:Son	UTSW	16	91,461,616 (GRCm39)	missense	probably damaging	1.00
R0041:Son	UTSW	16	91,456,221 (GRCm39)	missense	probably damaging	1.00
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0048:Son	UTSW	16	91,455,865 (GRCm39)	missense	possibly damaging	0.94
R0056:Son	UTSW	16	91,475,043 (GRCm39)	missense	possibly damaging	0.86
R0227:Son	UTSW	16	91,453,761 (GRCm39)	missense	probably damaging	0.99
R0256:Son	UTSW	16	91,453,472 (GRCm39)	missense	possibly damaging	0.95
R0302:Son	UTSW	16	91,453,032 (GRCm39)	missense	probably damaging	1.00
R0815:Son	UTSW	16	91,452,372 (GRCm39)	missense	probably damaging	0.98
R1255:Son	UTSW	16	91,461,583 (GRCm39)	missense	probably damaging	1.00
R1457:Son	UTSW	16	91,453,974 (GRCm39)	missense	probably damaging	1.00
R1459:Son	UTSW	16	91,452,230 (GRCm39)	missense	possibly damaging	0.93
R1535:Son	UTSW	16	91,456,622 (GRCm39)	missense	probably damaging	0.99
R1587:Son	UTSW	16	91,456,606 (GRCm39)	missense	probably damaging	1.00
R1605:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R1629:Son	UTSW	16	91,454,510 (GRCm39)	missense	probably damaging	1.00
R1711:Son	UTSW	16	91,457,114 (GRCm39)	intron	probably benign
R2138:Son	UTSW	16	91,456,260 (GRCm39)	missense	possibly damaging	0.95
R2245:Son	UTSW	16	91,444,848 (GRCm39)	splice site	probably null
R2351:Son	UTSW	16	91,454,547 (GRCm39)	missense	probably damaging	0.98
R2434:Son	UTSW	16	91,451,575 (GRCm39)	missense	probably damaging	1.00
R2870:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2871:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2872:Son	UTSW	16	91,461,205 (GRCm39)	splice site	probably null
R2889:Son	UTSW	16	91,456,787 (GRCm39)	unclassified	probably benign
R3712:Son	UTSW	16	91,453,614 (GRCm39)	missense	probably damaging	0.99
R3913:Son	UTSW	16	91,456,999 (GRCm39)	intron	probably benign
R4172:Son	UTSW	16	91,456,250 (GRCm39)	missense	probably damaging	1.00
R4301:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4302:Son	UTSW	16	91,455,299 (GRCm39)	missense	possibly damaging	0.53
R4770:Son	UTSW	16	91,455,756 (GRCm39)	missense	probably damaging	0.96
R4881:Son	UTSW	16	91,472,397 (GRCm39)	missense	probably benign	0.31
R5020:Son	UTSW	16	91,453,263 (GRCm39)	missense	probably damaging	1.00
R5032:Son	UTSW	16	91,454,552 (GRCm39)	missense	probably damaging	1.00
R5151:Son	UTSW	16	91,452,587 (GRCm39)	missense	probably damaging	1.00
R5153:Son	UTSW	16	91,451,910 (GRCm39)	missense	possibly damaging	0.86
R5215:Son	UTSW	16	91,453,563 (GRCm39)	missense	probably damaging	0.99
R5243:Son	UTSW	16	91,451,621 (GRCm39)	missense	probably damaging	1.00
R5354:Son	UTSW	16	91,452,627 (GRCm39)	missense	probably damaging	0.99
R5529:Son	UTSW	16	91,452,354 (GRCm39)	missense	probably damaging	1.00
R5696:Son	UTSW	16	91,468,301 (GRCm39)	missense	possibly damaging	0.67
R5763:Son	UTSW	16	91,454,378 (GRCm39)	missense	probably damaging	1.00
R5766:Son	UTSW	16	91,461,875 (GRCm39)	intron	probably benign
R5788:Son	UTSW	16	91,456,940 (GRCm39)	intron	probably benign
R5992:Son	UTSW	16	91,455,792 (GRCm39)	missense	probably benign	0.04
R6314:Son	UTSW	16	91,457,298 (GRCm39)	intron	probably benign
R6371:Son	UTSW	16	91,471,629 (GRCm39)
R6429:Son	UTSW	16	91,455,054 (GRCm39)	missense	probably benign	0.33
R6451:Son	UTSW	16	91,454,490 (GRCm39)	missense	probably damaging	0.99
R6489:Son	UTSW	16	91,452,044 (GRCm39)	missense	possibly damaging	0.70
R6513:Son	UTSW	16	91,456,835 (GRCm39)	intron	probably benign
R6753:Son	UTSW	16	91,454,076 (GRCm39)	missense	probably damaging	0.99
R6916:Son	UTSW	16	91,451,673 (GRCm39)	missense	probably damaging	0.97
R7070:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7079:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7110:Son	UTSW	16	91,453,406 (GRCm39)	missense	probably benign	0.01
R7120:Son	UTSW	16	91,467,414 (GRCm39)	missense	unknown
R7120:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7167:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7205:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7208:Son	UTSW	16	91,458,990 (GRCm39)	missense	unknown
R7219:Son	UTSW	16	91,461,889 (GRCm39)	missense	unknown
R7249:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7328:Son	UTSW	16	91,455,278 (GRCm39)	missense	probably benign	0.33
R7330:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7374:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7405:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7420:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7424:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7464:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7514:Son	UTSW	16	91,451,748 (GRCm39)	missense	probably damaging	0.99
R7555:Son	UTSW	16	91,455,810 (GRCm39)	missense	probably damaging	0.99
R7645:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R7716:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R7718:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7778:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7824:Son	UTSW	16	91,453,416 (GRCm39)	missense	probably damaging	0.99
R7856:Son	UTSW	16	91,456,146 (GRCm39)	missense	probably damaging	0.99
R7870:Son	UTSW	16	91,453,486 (GRCm39)	unclassified	probably benign
R7928:Son	UTSW	16	91,453,729 (GRCm39)	unclassified	probably benign
R7972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R7978:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8000:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8192:Son	UTSW	16	91,452,437 (GRCm39)	missense	possibly damaging	0.91
R8221:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8227:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8233:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8255:Son	UTSW	16	91,461,824 (GRCm39)	missense	unknown
R8292:Son	UTSW	16	91,453,545 (GRCm39)	missense	possibly damaging	0.93
R8407:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8468:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R8495:Son	UTSW	16	91,457,183 (GRCm39)	small deletion	probably benign
R8772:Son	UTSW	16	91,454,826 (GRCm39)	missense	possibly damaging	0.65
R8796:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8862:Son	UTSW	16	91,453,734 (GRCm39)	missense	probably damaging	1.00
R8962:Son	UTSW	16	91,455,057 (GRCm39)	missense	possibly damaging	0.91
R8972:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R8991:Son	UTSW	16	91,453,608 (GRCm39)	missense	possibly damaging	0.95
R8991:Son	UTSW	16	91,453,366 (GRCm39)	missense	probably benign	0.04
R9086:Son	UTSW	16	91,467,418 (GRCm39)	missense	unknown
R9138:Son	UTSW	16	91,452,006 (GRCm39)	missense	possibly damaging	0.80
R9232:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9241:Son	UTSW	16	91,454,122 (GRCm39)	missense	probably damaging	0.96
R9258:Son	UTSW	16	91,474,570 (GRCm39)	missense	unknown
R9328:Son	UTSW	16	91,452,645 (GRCm39)	missense	possibly damaging	0.67
R9420:Son	UTSW	16	91,454,508 (GRCm39)	missense	probably damaging	0.98
R9468:Son	UTSW	16	91,454,439 (GRCm39)	missense	possibly damaging	0.53
R9500:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9516:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9595:Son	UTSW	16	91,454,241 (GRCm39)	missense	possibly damaging	0.73
R9679:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9719:Son	UTSW	16	91,456,440 (GRCm39)	missense	probably damaging	0.96
R9749:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
R9772:Son	UTSW	16	91,457,222 (GRCm39)	small deletion	probably benign
R9782:Son	UTSW	16	91,444,838 (GRCm39)	missense	probably damaging	0.99
R9788:Son	UTSW	16	91,453,699 (GRCm39)	unclassified	probably benign
RF007:Son	UTSW	16	91,456,257 (GRCm39)	missense	possibly damaging	0.53
RF041:Son	UTSW	16	91,453,579 (GRCm39)	unclassified	probably benign
Z1176:Son	UTSW	16	91,452,689 (GRCm39)	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GGCCATGATGCTTACAGGTTAGGAC -3'
(R):5'- GCTCTGTTGATAATGCTGGACCCTC -3'

Sequencing Primer
(F):5'- GCTTACAGGTTAGGACAAGACCC -3'
(R):5'- GCCTCCgtataggaatcagtataag -3'

Posted On

2014-01-29