Incidental Mutation 'R0096:Ccdc105'
ID155837
Institutional Source Beutler Lab
Gene Symbol Ccdc105
Ensembl Gene ENSMUSG00000078442
Gene Namecoiled-coil domain containing 105
Synonyms4931413A09Rik
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0096 (G1)
Quality Score36
Status Validated
Chromosome10
Chromosomal Location78746926-78753065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78748705 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 328 (I328L)
Ref Sequence ENSEMBL: ENSMUSP00000101022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105383]
Predicted Effect probably benign
Transcript: ENSMUST00000105383
AA Change: I328L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101022
Gene: ENSMUSG00000078442
AA Change: I328L

DomainStartEndE-ValueType
Pfam:Tektin 115 470 1.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210562
Meta Mutation Damage Score 0.0765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Olfr910 A T 9: 38,539,536 I214F probably damaging Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Serpinb1c T A 13: 32,886,283 probably benign Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r105 A G 17: 20,227,479 F361S possibly damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Wdr59 T C 8: 111,504,373 N68D probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Ccdc105
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Ccdc105 APN 10 78750569 missense probably damaging 1.00
IGL01632:Ccdc105 APN 10 78748702 missense probably benign 0.01
IGL02473:Ccdc105 APN 10 78750594 missense probably benign 0.05
IGL02606:Ccdc105 APN 10 78748466 missense probably benign 0.01
IGL03356:Ccdc105 APN 10 78747132 missense possibly damaging 0.52
R0096:Ccdc105 UTSW 10 78748705 missense probably benign 0.01
R0666:Ccdc105 UTSW 10 78750547 missense probably benign 0.04
R1756:Ccdc105 UTSW 10 78747197 missense probably damaging 0.96
R1757:Ccdc105 UTSW 10 78747224 missense probably benign 0.02
R1765:Ccdc105 UTSW 10 78748668 missense probably benign 0.21
R1956:Ccdc105 UTSW 10 78750539 critical splice donor site probably null
R2305:Ccdc105 UTSW 10 78748502 missense probably damaging 1.00
R3802:Ccdc105 UTSW 10 78748480 missense probably damaging 1.00
R3845:Ccdc105 UTSW 10 78748698 missense probably benign
R4023:Ccdc105 UTSW 10 78752893 missense probably benign 0.03
R4808:Ccdc105 UTSW 10 78752864 missense probably benign 0.02
R4812:Ccdc105 UTSW 10 78749216 missense probably benign 0.01
R5391:Ccdc105 UTSW 10 78752854 nonsense probably null
R5434:Ccdc105 UTSW 10 78748650 nonsense probably null
R6382:Ccdc105 UTSW 10 78752841 missense possibly damaging 0.90
R6743:Ccdc105 UTSW 10 78752892 missense probably benign 0.01
R6749:Ccdc105 UTSW 10 78752838 missense possibly damaging 0.95
R7177:Ccdc105 UTSW 10 78752490 missense probably damaging 1.00
X0057:Ccdc105 UTSW 10 78750541 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCTCATTAGCCCCAAAGTCATGGTC -3'
(R):5'- ACAGCACCCATTCATTCACAGGTTC -3'

Sequencing Primer
(F):5'- GGTCATTCTTTCCTGGAGATTGG -3'
(R):5'- TGGTCCACCACCAGAGAGAG -3'
Posted On2014-02-07