Incidental Mutation 'R0096:Serpinb1c'
ID155839
Institutional Source Beutler Lab
Gene Symbol Serpinb1c
Ensembl Gene ENSMUSG00000079049
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 1c
Synonymsovalbumin, EIC
MMRRC Submission 038382-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0096 (G1)
Quality Score78
Status Validated
Chromosome13
Chromosomal Location32881434-32898211 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32886283 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021834] [ENSMUST00000221019]
Predicted Effect probably benign
Transcript: ENSMUST00000021834
SMART Domains Protein: ENSMUSP00000021834
Gene: ENSMUSG00000079049

DomainStartEndE-ValueType
SERPIN 13 375 1.67e-167 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117305
Gene: ENSMUSG00000079049

DomainStartEndE-ValueType
SERPIN 13 201 3.7e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221019
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.5%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,188 Q374P probably damaging Het
4933405L10Rik A T 8: 105,708,931 probably null Het
Adamts3 G A 5: 89,701,717 Q615* probably null Het
Adamtsl3 T A 7: 82,465,699 probably benign Het
Anks1b T C 10: 90,074,062 S48P possibly damaging Het
Arfip2 T A 7: 105,638,230 K94N probably damaging Het
Arhgap42 G T 9: 9,009,313 N524K probably damaging Het
Arhgef28 T G 13: 97,931,254 T1388P probably damaging Het
Arid4b T C 13: 14,129,194 V68A probably benign Het
BC005537 T C 13: 24,805,940 F129L probably damaging Het
Capn3 A T 2: 120,502,529 H592L possibly damaging Het
Ccdc105 T A 10: 78,748,705 I328L probably benign Het
Dglucy A T 12: 100,838,651 I134F possibly damaging Het
Dhh T A 15: 98,893,988 M380L probably benign Het
Dnaic2 A C 11: 114,754,332 D531A probably benign Het
Dthd1 A T 5: 62,843,040 R568S possibly damaging Het
Efr3a A G 15: 65,855,441 N613S probably damaging Het
Epb41l5 T A 1: 119,623,911 probably benign Het
Ermp1 A G 19: 29,631,388 Y164H possibly damaging Het
Fam120c CCAGCAGCAGCAGCAGCA CCAGCAGCAGCAGCA X: 151,344,345 probably benign Het
Fbrs C T 7: 127,489,487 A145V probably damaging Het
Gm4736 T C 6: 132,115,606 noncoding transcript Het
Gm9873 A T 2: 169,021,109 noncoding transcript Het
Grik1 T C 16: 88,034,226 M219V possibly damaging Het
Gtsf1l C T 2: 163,087,536 C9Y probably damaging Het
Itih5 G A 2: 10,251,378 R885Q probably benign Het
Kdm4c A G 4: 74,357,343 E752G probably damaging Het
Ksr1 A G 11: 79,038,247 probably benign Het
Lama1 T A 17: 67,805,413 F2283I probably benign Het
Luc7l3 A G 11: 94,301,494 probably benign Het
Lypd8 A T 11: 58,386,757 M122L probably benign Het
Map1a A G 2: 121,301,505 E696G probably damaging Het
Mrps34 A G 17: 24,895,669 D110G probably damaging Het
Myh11 T A 16: 14,204,367 K1710M possibly damaging Het
Myo1d A G 11: 80,484,332 L972P probably damaging Het
Nos1ap T C 1: 170,329,247 D214G probably damaging Het
Olfr1224-ps1 A T 2: 89,156,296 M293K probably benign Het
Olfr910 A T 9: 38,539,536 I214F probably damaging Het
Pate4 T G 9: 35,611,834 T5P probably damaging Het
Pygl A T 12: 70,191,166 probably benign Het
Samd4 A T 14: 47,064,297 M252L possibly damaging Het
Sis A T 3: 72,928,267 W921R probably damaging Het
Skint5 A T 4: 113,597,768 probably benign Het
Slc27a6 T C 18: 58,598,757 probably benign Het
Sycp2 G T 2: 178,403,735 Q31K probably damaging Het
Taar7f A G 10: 24,050,254 M249V probably benign Het
Tarm1 T C 7: 3,497,551 T79A probably benign Het
Trf A G 9: 103,222,159 F300L probably damaging Het
Vmn1r69 T A 7: 10,580,058 I170F probably damaging Het
Vmn2r105 A G 17: 20,227,479 F361S possibly damaging Het
Vmn2r79 A G 7: 87,037,319 Y636C probably damaging Het
Wdr59 T C 8: 111,504,373 N68D probably damaging Het
Zfp345 T A 2: 150,472,300 H439L probably damaging Het
Other mutations in Serpinb1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00490:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00497:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00501:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00567:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00575:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00585:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00586:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00588:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00589:Serpinb1c APN 13 32883975 missense probably damaging 0.99
IGL00983:Serpinb1c APN 13 32884224 missense possibly damaging 0.52
IGL01589:Serpinb1c APN 13 32886172 missense probably damaging 1.00
IGL03393:Serpinb1c APN 13 32882061 missense probably damaging 1.00
R0711:Serpinb1c UTSW 13 32886283 splice site probably benign
R1222:Serpinb1c UTSW 13 32896951 missense possibly damaging 0.53
R1301:Serpinb1c UTSW 13 32896960 nonsense probably null
R1570:Serpinb1c UTSW 13 32896990 missense probably benign 0.05
R1574:Serpinb1c UTSW 13 32888996 missense possibly damaging 0.89
R1574:Serpinb1c UTSW 13 32888996 missense possibly damaging 0.89
R1891:Serpinb1c UTSW 13 32884252 missense probably benign 0.35
R4932:Serpinb1c UTSW 13 32882164 missense probably damaging 1.00
R5831:Serpinb1c UTSW 13 32897098 start codon destroyed probably null 1.00
R6010:Serpinb1c UTSW 13 32882059 missense probably damaging 1.00
R6701:Serpinb1c UTSW 13 32896941 missense probably benign 0.37
R7522:Serpinb1c UTSW 13 32882217 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCACTGCTCAGCCTCTCACC -3'
(R):5'- CCACTACAGCACTGTAACCTTCAAAGAT -3'

Sequencing Primer
(F):5'- ACCTTCTGTTTGACCTTTGACC -3'
(R):5'- gaagggaagggaagggaaag -3'
Posted On2014-02-07