Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Rxra'

155848

Institutional Source

Beutler Lab

Gene Symbol

Rxra

Ensembl Gene

ENSMUSG00000015846

Gene Name

retinoid X receptor alpha

Synonyms

RXRalpha1, RXR alpha 1, 9530071D11Rik

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0265 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

27676440-27762957 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 27752430 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 305 (L305P)

Ref Sequence

ENSEMBL: ENSMUSP00000133044 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000166775]

AlphaFold

P28700

PDB Structure

CRYSTAL STRUCTURE OF A HETERODIMERIC COMPLEX OF RAR AND RXR LIGAND-BINDING DOMAINS [X-RAY DIFFRACTION]
Crystal Structure of the RARbeta/RXRalpha Ligand Binding Domain Heterodimer in Complex with 9-cis Retinoic Acid and a Fragment of the TRAP220 Coactivator [X-RAY DIFFRACTION]
Crystal structure of a mixed agonist-bound RAR-alpha and antagonist-bound RXR-alpha heterodimer ligand binding domains [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077257
AA Change: L305P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: L305P

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	18	132	4.2e-42	PFAM
ZnF_C4	137	208	1.76e-40	SMART
Blast:HOLI	233	265	1e-8	BLAST
HOLI	275	434	1.62e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100251
AA Change: L277P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: L277P

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	1	104	1.8e-38	PFAM
ZnF_C4	109	180	1.76e-40	SMART
Blast:HOLI	205	237	1e-8	BLAST
HOLI	247	406	1.62e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113934
AA Change: L277P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: L277P

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	1	104	1.8e-38	PFAM
ZnF_C4	109	180	1.76e-40	SMART
Blast:HOLI	205	237	1e-8	BLAST
HOLI	247	406	1.62e-53	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148756

Predicted Effect

probably damaging
Transcript: ENSMUST00000166775
AA Change: L305P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: L305P

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	17	132	6.5e-41	PFAM
ZnF_C4	137	208	1.76e-40	SMART
Blast:HOLI	233	265	1e-8	BLAST
HOLI	275	434	1.62e-53	SMART

Meta Mutation Damage Score

0.9752

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Rxra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01941:Rxra	APN	2	27754241	missense	probably damaging	1.00
IGL03006:Rxra	APN	2	27759645	missense	probably damaging	1.00
pinkie	UTSW	2	27752334	missense	probably damaging	0.98
R0578:Rxra	UTSW	2	27759570	missense	probably damaging	1.00
R1555:Rxra	UTSW	2	27748678	missense	probably benign	0.00
R1775:Rxra	UTSW	2	27756244	missense	probably damaging	1.00
R3725:Rxra	UTSW	2	27754277	missense	probably damaging	1.00
R3756:Rxra	UTSW	2	27741911	missense	probably damaging	1.00
R3804:Rxra	UTSW	2	27756260	missense	probably damaging	1.00
R3965:Rxra	UTSW	2	27752306	splice site	probably benign
R4490:Rxra	UTSW	2	27741195	missense	probably damaging	0.99
R4898:Rxra	UTSW	2	27741183	missense	probably damaging	1.00
R5154:Rxra	UTSW	2	27757868	critical splice donor site	probably null
R5651:Rxra	UTSW	2	27737341	missense	probably benign	0.25
R6880:Rxra	UTSW	2	27748656	missense	possibly damaging	0.64
R6913:Rxra	UTSW	2	27741174	missense	probably damaging	1.00
R7404:Rxra	UTSW	2	27741854	missense	probably damaging	0.99
R8324:Rxra	UTSW	2	27741183	missense	probably damaging	1.00
R9098:Rxra	UTSW	2	27748744	missense	possibly damaging	0.50
R9200:Rxra	UTSW	2	27737484	missense	possibly damaging	0.64
R9356:Rxra	UTSW	2	27759663	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTCAGAGTCCTTTCACTGTGCCAG -3'
(R):5'- CCAAGTTCCAAGGCTACACTCCTTC -3'

Sequencing Primer
(F):5'- CCTCCGATGGTTTGGGATG -3'
(R):5'- AGTCCCCTTGGCTATGAGAGAC -3'

Posted On

2014-02-10