Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Gabrg3'

155850

Institutional Source

Beutler Lab

Gene Symbol

Gabrg3

Ensembl Gene

ENSMUSG00000055026

Gene Name

gamma-aminobutyric acid (GABA) A receptor, subunit gamma 3

Synonyms

Gabrg-3, B230362M20Rik

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0265 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

56716465-57387188 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 57381617 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 58 (Y58*)

Ref Sequence

ENSEMBL: ENSMUSP00000067632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068394] [ENSMUST00000068911]

AlphaFold

P27681

Predicted Effect

probably null
Transcript: ENSMUST00000068394
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000065255
Gene: ENSMUSG00000055026
AA Change: Y58*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
SCOP:d1i9ba_	53	90	9e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000068911
AA Change: Y58*

SMART Domains

Protein: ENSMUSP00000067632
Gene: ENSMUSG00000055026
AA Change: Y58*

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
Pfam:Neur_chan_LBD	47	253	2.9e-51	PFAM
Pfam:Neur_chan_memb	260	461	1.4e-39	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171965

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Alox5	T	C	6: 116,420,362	Y287C	probably benign	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Gabrg3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Gabrg3	APN	7	57381667	missense	probably damaging	0.99
IGL01501:Gabrg3	APN	7	56724466	missense	probably damaging	0.99
IGL02637:Gabrg3	APN	7	56735027	missense	probably damaging	0.99
IGL02707:Gabrg3	APN	7	56982691	nonsense	probably null
IGL03084:Gabrg3	APN	7	56735064	missense	possibly damaging	0.91
IGL03237:Gabrg3	APN	7	56982712	splice site	probably null
IGL03275:Gabrg3	APN	7	56773347	missense	probably damaging	1.00
IGL03309:Gabrg3	APN	7	56982685	missense	probably damaging	1.00
R0612:Gabrg3	UTSW	7	56729706	missense	probably damaging	0.99
R0627:Gabrg3	UTSW	7	56724595	missense	probably damaging	0.99
R0676:Gabrg3	UTSW	7	56724421	missense	probably damaging	0.99
R1178:Gabrg3	UTSW	7	56735091	missense	probably benign	0.01
R1600:Gabrg3	UTSW	7	56735074	nonsense	probably null
R1702:Gabrg3	UTSW	7	56985100	missense	probably damaging	0.98
R1836:Gabrg3	UTSW	7	56729641	missense	probably damaging	1.00
R2327:Gabrg3	UTSW	7	56735087	missense	probably benign	0.01
R3816:Gabrg3	UTSW	7	57381664	nonsense	probably null
R3818:Gabrg3	UTSW	7	57381664	nonsense	probably null
R3819:Gabrg3	UTSW	7	57381664	nonsense	probably null
R4905:Gabrg3	UTSW	7	56724556	missense	probably damaging	0.98
R5643:Gabrg3	UTSW	7	56773284	missense	possibly damaging	0.95
R6088:Gabrg3	UTSW	7	56985078	missense	probably damaging	1.00
R6862:Gabrg3	UTSW	7	56773311	missense	possibly damaging	0.54
R6879:Gabrg3	UTSW	7	57381639	missense	probably damaging	1.00
R7075:Gabrg3	UTSW	7	57323696	missense	probably damaging	0.99
R7305:Gabrg3	UTSW	7	56735085	missense	probably benign	0.01
R7594:Gabrg3	UTSW	7	56982695	missense	possibly damaging	0.90
R7793:Gabrg3	UTSW	7	57179580	missense	probably benign	0.00
R7886:Gabrg3	UTSW	7	56724481	missense	probably damaging	1.00
R7989:Gabrg3	UTSW	7	56724641	missense	possibly damaging	0.70
R8002:Gabrg3	UTSW	7	56734968	missense	possibly damaging	0.90
R8203:Gabrg3	UTSW	7	56773260	missense	possibly damaging	0.65
R8875:Gabrg3	UTSW	7	56729766	missense	probably damaging	1.00
R8933:Gabrg3	UTSW	7	56984958	missense	probably damaging	0.96
R9027:Gabrg3	UTSW	7	56773374	missense	possibly damaging	0.88
R9090:Gabrg3	UTSW	7	57179638	missense	probably benign	0.03
R9229:Gabrg3	UTSW	7	56724520	missense	probably damaging	0.99
R9271:Gabrg3	UTSW	7	57179638	missense	probably benign	0.03
R9673:Gabrg3	UTSW	7	57323674	missense	probably damaging	0.98
R9734:Gabrg3	UTSW	7	56985160	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGTCTAAACCTACGCAGCAAGC -3'
(R):5'- TGGGCTGGGCTGTTCCATTAAC -3'

Sequencing Primer
(F):5'- AGCTCAGAACCCTAGCGG -3'
(R):5'- GGGATTTTCCACCCATTTTAGAAGC -3'

Posted On

2014-02-10