Incidental Mutation 'R0265:Gabrg3'
ID155850
Institutional Source Beutler Lab
Gene Symbol Gabrg3
Ensembl Gene ENSMUSG00000055026
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit gamma 3
SynonymsGabrg-3, B230362M20Rik
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0265 (G1)
Quality Score58
Status Validated
Chromosome7
Chromosomal Location56716465-57387188 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 57381617 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 58 (Y58*)
Ref Sequence ENSEMBL: ENSMUSP00000067632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068394] [ENSMUST00000068911]
Predicted Effect probably null
Transcript: ENSMUST00000068394
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000065255
Gene: ENSMUSG00000055026
AA Change: Y58*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
SCOP:d1i9ba_ 53 90 9e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000068911
AA Change: Y58*
SMART Domains Protein: ENSMUSP00000067632
Gene: ENSMUSG00000055026
AA Change: Y58*

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 47 253 2.9e-51 PFAM
Pfam:Neur_chan_memb 260 461 1.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171965
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-aminobutyric acid (GABA) receptor. GABA is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA-A receptors, which are ligand-gated chloride channels. Chloride conductance of these channels can be modulated by agents such as benzodiazepines that bind to the GABA-A receptor. GABA-A receptors are pentameric, consisting of proteins from several subunit classes: alpha, beta, gamma, delta and rho. The protein encoded by this gene is a gamma subunit, which contains the benzodiazepine binding site. Two transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Gabrg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Gabrg3 APN 7 57381667 missense probably damaging 0.99
IGL01501:Gabrg3 APN 7 56724466 missense probably damaging 0.99
IGL02637:Gabrg3 APN 7 56735027 missense probably damaging 0.99
IGL02707:Gabrg3 APN 7 56982691 nonsense probably null
IGL03084:Gabrg3 APN 7 56735064 missense possibly damaging 0.91
IGL03237:Gabrg3 APN 7 56982712 splice site probably null
IGL03275:Gabrg3 APN 7 56773347 missense probably damaging 1.00
IGL03309:Gabrg3 APN 7 56982685 missense probably damaging 1.00
R0612:Gabrg3 UTSW 7 56729706 missense probably damaging 0.99
R0627:Gabrg3 UTSW 7 56724595 missense probably damaging 0.99
R0676:Gabrg3 UTSW 7 56724421 missense probably damaging 0.99
R1178:Gabrg3 UTSW 7 56735091 missense probably benign 0.01
R1600:Gabrg3 UTSW 7 56735074 nonsense probably null
R1702:Gabrg3 UTSW 7 56985100 missense probably damaging 0.98
R1836:Gabrg3 UTSW 7 56729641 missense probably damaging 1.00
R2327:Gabrg3 UTSW 7 56735087 missense probably benign 0.01
R3816:Gabrg3 UTSW 7 57381664 nonsense probably null
R3818:Gabrg3 UTSW 7 57381664 nonsense probably null
R3819:Gabrg3 UTSW 7 57381664 nonsense probably null
R4905:Gabrg3 UTSW 7 56724556 missense probably damaging 0.98
R5643:Gabrg3 UTSW 7 56773284 missense possibly damaging 0.95
R6088:Gabrg3 UTSW 7 56985078 missense probably damaging 1.00
R6862:Gabrg3 UTSW 7 56773311 missense possibly damaging 0.54
R6879:Gabrg3 UTSW 7 57381639 missense probably damaging 1.00
R7075:Gabrg3 UTSW 7 57323696 missense probably damaging 0.99
R7305:Gabrg3 UTSW 7 56735085 missense probably benign 0.01
R7594:Gabrg3 UTSW 7 56982695 missense possibly damaging 0.90
R7793:Gabrg3 UTSW 7 57179580 missense probably benign 0.00
R7886:Gabrg3 UTSW 7 56724481 missense probably damaging 1.00
R7989:Gabrg3 UTSW 7 56724641 missense possibly damaging 0.70
R8002:Gabrg3 UTSW 7 56734968 missense possibly damaging 0.90
R8203:Gabrg3 UTSW 7 56773260 missense possibly damaging 0.65
R8875:Gabrg3 UTSW 7 56729766 missense probably damaging 1.00
R8933:Gabrg3 UTSW 7 56984958 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAAGTCTAAACCTACGCAGCAAGC -3'
(R):5'- TGGGCTGGGCTGTTCCATTAAC -3'

Sequencing Primer
(F):5'- AGCTCAGAACCCTAGCGG -3'
(R):5'- GGGATTTTCCACCCATTTTAGAAGC -3'
Posted On2014-02-10