Incidental Mutation 'R1368:Olfr38'
ID155873
Institutional Source Beutler Lab
Gene Symbol Olfr38
Ensembl Gene ENSMUSG00000095236
Gene Nameolfactory receptor 38
SynonymsMOR257-2, 18A, GA_x6K02T2P3E9-4797841-4796888
MMRRC Submission 039433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1368 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42756404-42763231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42762679 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 209 (T209K)
Ref Sequence ENSEMBL: ENSMUSP00000149726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074499] [ENSMUST00000215796]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074499
AA Change: T209K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000093654
Gene: ENSMUSG00000095236
AA Change: T209K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.8e-52 PFAM
Pfam:7tm_1 41 290 5.4e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215796
AA Change: T209K

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.4409 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,159,478 Q2341R possibly damaging Het
9930021J03Rik C A 19: 29,716,396 S1966I probably damaging Het
Abca13 A G 11: 9,291,836 D1233G probably benign Het
Abcc8 G A 7: 46,122,860 R832W probably damaging Het
Atp10b A G 11: 43,202,154 T439A probably damaging Het
C130073F10Rik T A 4: 101,890,756 N74Y possibly damaging Het
Cct8 G A 16: 87,491,312 S124L probably damaging Het
Cdh9 T A 15: 16,848,482 probably benign Het
Cep290 C T 10: 100,494,966 probably benign Het
Chrng T A 1: 87,205,853 L10H probably damaging Het
Cnn3 T C 3: 121,457,137 L189S probably benign Het
Cog4 A G 8: 110,858,525 probably benign Het
Cxcl12 A G 6: 117,176,150 probably benign Het
Eif2b2 G A 12: 85,223,456 A257T probably damaging Het
Fam189a1 A T 7: 64,819,877 V41E probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Fktn G A 4: 53,734,880 G173R probably damaging Het
Gabbr2 T C 4: 46,674,464 N841S probably benign Het
Gm5622 T A 14: 51,662,190 V167E possibly damaging Het
Gnaq T C 19: 16,378,287 V289A probably benign Het
Gpatch2l T G 12: 86,260,665 D272E possibly damaging Het
Gzmg G A 14: 56,157,806 T74I probably benign Het
Ikzf2 G A 1: 69,539,315 A271V possibly damaging Het
Lig4 T C 8: 9,971,176 D868G possibly damaging Het
Mfsd6 T C 1: 52,708,605 E367G possibly damaging Het
Mpz T C 1: 171,159,964 L223P probably damaging Het
Muc3 T C 5: 137,146,826 probably benign Het
Pdcd2 G T 17: 15,526,584 N104K probably damaging Het
Pigg G T 5: 108,317,288 G129V probably damaging Het
Ppp3cc T C 14: 70,245,862 Y254C probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Psg23 A G 7: 18,614,720 V54A probably benign Het
Psmd3 A G 11: 98,682,920 D64G probably damaging Het
Psmg2 CTTCAGTT CTTCAGTTCAGTT 18: 67,646,025 probably null Het
Ptgdr T A 14: 44,853,342 I320F probably damaging Het
Rad50 T A 11: 53,683,245 K722* probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rgs9 G A 11: 109,248,151 S255L probably benign Het
Ror1 C T 4: 100,441,137 P569L possibly damaging Het
Rsad2 T C 12: 26,447,148 probably null Het
Scn8a A G 15: 101,035,541 D1501G probably damaging Het
Sema3c A G 5: 17,678,332 T313A possibly damaging Het
Serpinc1 T A 1: 160,993,524 F59L probably damaging Het
Sike1 A G 3: 102,996,184 D63G possibly damaging Het
Slc25a11 T A 11: 70,645,526 probably null Het
Slc32a1 A G 2: 158,611,320 M27V probably benign Het
Smc5 A G 19: 23,210,443 V1003A probably damaging Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Topaz1 A G 9: 122,748,250 E75G possibly damaging Het
Tspan3 A T 9: 56,147,499 V48E probably benign Het
Ugt1a6b T C 1: 88,107,636 I232T probably benign Het
Unc79 A G 12: 103,156,513 K2290E probably damaging Het
Vmn1r19 T C 6: 57,404,671 F70L probably benign Het
Other mutations in Olfr38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01551:Olfr38 APN 6 42762112 missense probably damaging 0.99
IGL01567:Olfr38 APN 6 42762727 missense probably benign 0.07
IGL02097:Olfr38 APN 6 42762460 missense probably damaging 0.98
IGL02186:Olfr38 APN 6 42762946 missense probably null 0.96
IGL02473:Olfr38 APN 6 42762706 missense probably damaging 1.00
R0541:Olfr38 UTSW 6 42762220 missense probably damaging 1.00
R1210:Olfr38 UTSW 6 42762667 missense possibly damaging 0.79
R2383:Olfr38 UTSW 6 42762459 missense probably benign 0.44
R4614:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4616:Olfr38 UTSW 6 42762418 missense probably benign 0.07
R4844:Olfr38 UTSW 6 42762460 missense probably damaging 0.98
R5121:Olfr38 UTSW 6 42762997 nonsense probably null
R5951:Olfr38 UTSW 6 42762559 missense probably damaging 1.00
R6061:Olfr38 UTSW 6 42762965 missense probably damaging 0.99
R6336:Olfr38 UTSW 6 42762657 missense probably damaging 1.00
R7414:Olfr38 UTSW 6 42762828 missense probably damaging 1.00
X0018:Olfr38 UTSW 6 42762935 missense probably damaging 0.99
Z1177:Olfr38 UTSW 6 42762207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGGTCAGTGGCTCCATCAAC -3'
(R):5'- GGGTTCAGCATGGGTGTCAAGATAG -3'

Sequencing Primer
(F):5'- AGTGGCTCCATCAACTCTCTTG -3'
(R):5'- GAGACATCAACTTCTCCTGAAGG -3'
Posted On2014-02-11