Mutagenetix > Incidental Mutation

Incidental Mutation 'R1370:Sh3bp4'

155912

Institutional Source

Beutler Lab

Gene Symbol

Sh3bp4

Ensembl Gene

ENSMUSG00000036206

Gene Name

SH3-domain binding protein 4

Synonyms

BOG25

MMRRC Submission

039434-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1370 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

89070415-89155068 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 89143772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 114 (Y114F)

Ref Sequence

ENSEMBL: ENSMUSP00000067581 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066279]

AlphaFold

Q921I6

Predicted Effect

probably benign
Transcript: ENSMUST00000066279
AA Change: Y114F

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000067581
Gene: ENSMUSG00000036206
AA Change: Y114F

Domain	Start	End	E-Value	Type
SH3	58	113	5.04e-13	SMART
low complexity region	196	212	N/A	INTRINSIC
Pfam:ZU5	318	411	1.8e-12	PFAM
Pfam:SH3_2	657	721	3.5e-13	PFAM

Meta Mutation Damage Score

0.0720

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.6%
20x: 84.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 3 Asn-Pro-Phe (NPF) motifs, an SH3 domain, a PXXP motif, a bipartite nuclear targeting signal, and a tyrosine phosphorylation site. This protein is involved in cargo-specific control of clathrin-mediated endocytosis, specifically controlling the internalization of a specific protein receptor. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Adgra3	T	C	5: 49,960,787	I1140V	possibly damaging	Het
Adrb3	A	T	8: 27,227,770		probably null	Het
Afap1	A	G	5: 35,935,600	D16G	unknown	Het
AI593442	T	C	9: 52,678,008	K90E	probably damaging	Het
Aicda	A	T	6: 122,561,185	N101Y	probably benign	Het
Alx1	A	G	10: 103,028,492	S39P	possibly damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Arhgef5	T	A	6: 43,283,912	F1424I	probably damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
Bin1	A	G	18: 32,429,703	I416V	probably benign	Het
Bptf	A	T	11: 107,047,094	S2724T	probably damaging	Het
Brf1	A	T	12: 112,961,108		probably null	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cdan1	A	G	2: 120,719,139		probably null	Het
Chaf1a	A	T	17: 56,064,032	H639L	probably benign	Het
Chd1	G	A	17: 17,387,480	G430D	probably benign	Het
Clca3a2	T	C	3: 144,813,863		probably benign	Het
Clptm1	A	G	7: 19,633,872	V605A	possibly damaging	Het
Cmpk2	A	G	12: 26,471,452	D241G	probably damaging	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dennd4c	T	A	4: 86,811,510	I783N	probably damaging	Het
Dock10	A	G	1: 80,540,343	S1305P	probably damaging	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Gbp8	C	T	5: 105,016,576	A394T	possibly damaging	Het
Gm13023	T	A	4: 143,795,304	L497I	possibly damaging	Het
H1fx	A	G	6: 87,981,151	I69T	probably damaging	Het
Herc2	T	A	7: 56,168,873	C2771S	probably benign	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Klk11	A	G	7: 43,776,907	I22V	probably benign	Het
Krt6b	T	C	15: 101,677,552	D362G	probably damaging	Het
Lce1e	A	G	3: 92,707,843	S66P	unknown	Het
Letm1	A	T	5: 33,778,682		probably null	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Mrpl12	A	G	11: 120,485,301	S46G	probably benign	Het
Narfl	A	G	17: 25,776,988	E62G	probably benign	Het
Ndrg3	T	C	2: 156,938,650	E198G	probably damaging	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Pcdh20	A	G	14: 88,468,301	I521T	probably benign	Het
Pdzph1	T	C	17: 58,974,087	D400G	possibly damaging	Het
Per2	A	T	1: 91,445,557	S170T	possibly damaging	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rerg	A	T	6: 137,057,801		probably benign	Het
Sel1l3	G	T	5: 53,200,217	H144Q	possibly damaging	Het
Sept2	G	T	1: 93,499,106	V146L	probably damaging	Het
Setd1b	C	T	5: 123,160,685		probably benign	Het
Slc44a5	C	A	3: 154,243,159	T188K	probably benign	Het
Slco6d1	A	C	1: 98,423,094	I100L	probably benign	Het
Slfn4	G	T	11: 83,188,806	D441Y	probably damaging	Het
Smg1	T	C	7: 118,159,752		probably benign	Het
Snrpb2	A	G	2: 143,065,166		probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Stard9	T	C	2: 120,697,477	V1405A	probably benign	Het
Syt1	A	G	10: 108,690,922	L42P	probably damaging	Het
Tarbp1	T	C	8: 126,448,330	D789G	probably benign	Het
Tbcel	A	T	9: 42,450,062	D63E	probably damaging	Het
Tdrd3	A	T	14: 87,458,054		probably benign	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Tsc22d1	A	G	14: 76,437,664		probably benign	Het
Tsga10	G	T	1: 37,835,453	T117K	probably damaging	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Ttn	G	T	2: 76,847,151		probably benign	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het
Zbtb37	C	T	1: 161,032,022	E238K	probably benign	Het
Zfp354c	A	G	11: 50,815,840	I136T	probably benign	Het
Zfp384	G	A	6: 125,036,453	A479T	probably benign	Het
Zfp646	T	A	7: 127,879,864	N404K	probably damaging	Het

Other mutations in Sh3bp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Sh3bp4	APN	1	89143960	missense	probably benign
IGL01344:Sh3bp4	APN	1	89153236	missense	probably benign
IGL02025:Sh3bp4	APN	1	89145286	missense	probably benign	0.40
IGL02035:Sh3bp4	APN	1	89143690	missense	probably benign	0.00
IGL02389:Sh3bp4	APN	1	89145148	missense	probably damaging	0.99
IGL02430:Sh3bp4	APN	1	89153163	missense	probably null	0.00
IGL02546:Sh3bp4	APN	1	89143544	splice site	probably benign
IGL03327:Sh3bp4	APN	1	89144163	nonsense	probably null
I0000:Sh3bp4	UTSW	1	89137796	missense	probably benign	0.01
PIT4366001:Sh3bp4	UTSW	1	89145434	missense	probably benign
R0128:Sh3bp4	UTSW	1	89145314	missense	possibly damaging	0.54
R0130:Sh3bp4	UTSW	1	89145314	missense	possibly damaging	0.54
R1500:Sh3bp4	UTSW	1	89145488	missense	probably damaging	1.00
R2269:Sh3bp4	UTSW	1	89145592	missense	possibly damaging	0.62
R3407:Sh3bp4	UTSW	1	89145047	missense	possibly damaging	0.86
R3408:Sh3bp4	UTSW	1	89145047	missense	possibly damaging	0.86
R3615:Sh3bp4	UTSW	1	89137705	missense	probably damaging	0.99
R3616:Sh3bp4	UTSW	1	89137705	missense	probably damaging	0.99
R3721:Sh3bp4	UTSW	1	89145328	missense	possibly damaging	0.93
R3983:Sh3bp4	UTSW	1	89145869	missense	probably benign	0.00
R4631:Sh3bp4	UTSW	1	89144273	missense	probably damaging	1.00
R5024:Sh3bp4	UTSW	1	89145595	missense	probably damaging	1.00
R5040:Sh3bp4	UTSW	1	89144240	missense	probably damaging	1.00
R5249:Sh3bp4	UTSW	1	89137734	missense	probably damaging	1.00
R5306:Sh3bp4	UTSW	1	89144275	missense	probably damaging	0.99
R5319:Sh3bp4	UTSW	1	89145350	missense	probably benign
R5908:Sh3bp4	UTSW	1	89145883	missense	probably damaging	0.99
R6296:Sh3bp4	UTSW	1	89145489	missense	probably damaging	1.00
R6572:Sh3bp4	UTSW	1	89144921	missense	possibly damaging	0.78
R6660:Sh3bp4	UTSW	1	89153166	missense	possibly damaging	0.62
R6900:Sh3bp4	UTSW	1	89145767	missense	probably benign	0.00
R7319:Sh3bp4	UTSW	1	89153102	splice site	probably null
R7320:Sh3bp4	UTSW	1	89145494	missense	probably damaging	1.00
R7393:Sh3bp4	UTSW	1	89144448	missense	possibly damaging	0.79
R7516:Sh3bp4	UTSW	1	89145646	missense	probably damaging	1.00
R8402:Sh3bp4	UTSW	1	89145315	missense	probably benign	0.00
R8899:Sh3bp4	UTSW	1	89145575	missense	probably benign	0.45
R8915:Sh3bp4	UTSW	1	89152342	missense	probably damaging	0.99
R8953:Sh3bp4	UTSW	1	89144437	missense	probably damaging	0.97
R9137:Sh3bp4	UTSW	1	89144925	nonsense	probably null
R9718:Sh3bp4	UTSW	1	89145750	missense	probably damaging	0.99
RF016:Sh3bp4	UTSW	1	89145022	missense	probably benign
Z1176:Sh3bp4	UTSW	1	89145728	missense	probably benign	0.43

Predicted Primers

PCR Primer
(F):5'- TCGTAGACAACCCCACGCCTTTTG -3'
(R):5'- GTACTGGGCTGTGCATTCCCATTC -3'

Sequencing Primer
(F):5'- CCACGCCTTTTGGAAACG -3'
(R):5'- GCTGTGCATTCCCATTCAGAAAG -3'

Posted On

2014-02-11