Incidental Mutation 'R1370:Mettl5'
ID 155917
Institutional Source Beutler Lab
Gene Symbol Mettl5
Ensembl Gene ENSMUSG00000051730
Gene Name methyltransferase 5, N6-adenosine
Synonyms 2810410A08Rik
MMRRC Submission 039434-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.681) question?
Stock # R1370 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 69701542-69715959 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 69711764 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000060447] [ENSMUST00000060447] [ENSMUST00000060447] [ENSMUST00000142127] [ENSMUST00000142127]
AlphaFold Q8K1A0
Predicted Effect probably null
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135487
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Adgra3 T C 5: 50,118,129 (GRCm39) I1140V possibly damaging Het
Adrb3 A T 8: 27,717,798 (GRCm39) probably null Het
Afap1 A G 5: 36,092,944 (GRCm39) D16G unknown Het
AI593442 T C 9: 52,589,308 (GRCm39) K90E probably damaging Het
Aicda A T 6: 122,538,144 (GRCm39) N101Y probably benign Het
Alx1 A G 10: 102,864,353 (GRCm39) S39P possibly damaging Het
Ankrd52 A G 10: 128,224,565 (GRCm39) D781G possibly damaging Het
Arhgef5 T A 6: 43,260,846 (GRCm39) F1424I probably damaging Het
Atp10b G A 11: 43,042,482 (GRCm39) W14* probably null Het
Bin1 A G 18: 32,562,756 (GRCm39) I416V probably benign Het
Bptf A T 11: 106,937,920 (GRCm39) S2724T probably damaging Het
Brf1 A T 12: 112,924,728 (GRCm39) probably null Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Cd226 T A 18: 89,265,147 (GRCm39) S29T probably benign Het
Cdan1 A G 2: 120,549,620 (GRCm39) probably null Het
Chaf1a A T 17: 56,371,032 (GRCm39) H639L probably benign Het
Chd1 G A 17: 17,607,742 (GRCm39) G430D probably benign Het
Ciao3 A G 17: 25,995,962 (GRCm39) E62G probably benign Het
Clca3a2 T C 3: 144,519,624 (GRCm39) probably benign Het
Clptm1 A G 7: 19,367,797 (GRCm39) V605A possibly damaging Het
Cmpk2 A G 12: 26,521,451 (GRCm39) D241G probably damaging Het
Cryzl1 A G 16: 91,489,546 (GRCm39) V266A possibly damaging Het
Cyp2c68 A G 19: 39,729,400 (GRCm39) L29P probably damaging Het
Dennd3 A C 15: 73,412,703 (GRCm39) probably benign Het
Dennd4c T A 4: 86,729,747 (GRCm39) I783N probably damaging Het
Dock10 A G 1: 80,518,060 (GRCm39) S1305P probably damaging Het
Eml6 T G 11: 29,783,085 (GRCm39) S599R probably benign Het
Gbp8 C T 5: 105,164,442 (GRCm39) A394T possibly damaging Het
H1f10 A G 6: 87,958,133 (GRCm39) I69T probably damaging Het
Herc2 T A 7: 55,818,621 (GRCm39) C2771S probably benign Het
Ism1 A T 2: 139,573,994 (GRCm39) I115F possibly damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itgb8 C T 12: 119,134,738 (GRCm39) G443E probably benign Het
Kalrn T A 16: 33,795,954 (GRCm39) I1274F possibly damaging Het
Klk1b11 A G 7: 43,426,331 (GRCm39) I22V probably benign Het
Krt6b T C 15: 101,585,987 (GRCm39) D362G probably damaging Het
Lce1e A G 3: 92,615,150 (GRCm39) S66P unknown Het
Letm1 A T 5: 33,936,026 (GRCm39) probably null Het
Lrrcc1 G T 3: 14,613,174 (GRCm39) V299L probably benign Het
Mrpl12 A G 11: 120,376,127 (GRCm39) S46G probably benign Het
Ndrg3 T C 2: 156,780,570 (GRCm39) E198G probably damaging Het
Or5ac16 A G 16: 59,022,043 (GRCm39) S249P probably damaging Het
Pcdh20 A G 14: 88,705,737 (GRCm39) I521T probably benign Het
Pdzph1 T C 17: 59,281,082 (GRCm39) D400G possibly damaging Het
Per2 A T 1: 91,373,279 (GRCm39) S170T possibly damaging Het
Pramel25 T A 4: 143,521,874 (GRCm39) L497I possibly damaging Het
Pros1 A G 16: 62,739,921 (GRCm39) K457E probably benign Het
Rer1 T A 4: 155,160,081 (GRCm39) M156L probably benign Het
Rerg A T 6: 137,034,799 (GRCm39) probably benign Het
Sel1l3 G T 5: 53,357,559 (GRCm39) H144Q possibly damaging Het
Septin2 G T 1: 93,426,828 (GRCm39) V146L probably damaging Het
Setd1b C T 5: 123,298,748 (GRCm39) probably benign Het
Sh3bp4 A T 1: 89,071,494 (GRCm39) Y114F probably benign Het
Slc44a5 C A 3: 153,948,796 (GRCm39) T188K probably benign Het
Slco6d1 A C 1: 98,350,819 (GRCm39) I100L probably benign Het
Slfn4 G T 11: 83,079,632 (GRCm39) D441Y probably damaging Het
Smg1 T C 7: 117,758,975 (GRCm39) probably benign Het
Snrpb2 A G 2: 142,907,086 (GRCm39) probably benign Het
Sspo T A 6: 48,425,560 (GRCm39) S60R probably benign Het
Stard9 T C 2: 120,527,958 (GRCm39) V1405A probably benign Het
Syt1 A G 10: 108,526,783 (GRCm39) L42P probably damaging Het
Tarbp1 T C 8: 127,175,069 (GRCm39) D789G probably benign Het
Tbcel A T 9: 42,361,358 (GRCm39) D63E probably damaging Het
Tdrd3 A T 14: 87,695,490 (GRCm39) probably benign Het
Tiam1 A T 16: 89,695,109 (GRCm39) I116N probably benign Het
Tsc22d1 A G 14: 76,675,104 (GRCm39) probably benign Het
Tsga10 G T 1: 37,874,534 (GRCm39) T117K probably damaging Het
Ttc3 A G 16: 94,219,496 (GRCm39) S492G possibly damaging Het
Ttn G T 2: 76,677,495 (GRCm39) probably benign Het
Wasf3 T C 5: 146,407,018 (GRCm39) probably benign Het
Zbtb37 C T 1: 160,859,592 (GRCm39) E238K probably benign Het
Zfp354c A G 11: 50,706,667 (GRCm39) I136T probably benign Het
Zfp384 G A 6: 125,013,416 (GRCm39) A479T probably benign Het
Zfp646 T A 7: 127,479,036 (GRCm39) N404K probably damaging Het
Other mutations in Mettl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Mettl5 APN 2 69,711,659 (GRCm39) missense probably damaging 0.96
R1355:Mettl5 UTSW 2 69,711,764 (GRCm39) splice site probably null
R1416:Mettl5 UTSW 2 69,701,633 (GRCm39) missense possibly damaging 0.79
R1463:Mettl5 UTSW 2 69,715,590 (GRCm39) splice site probably benign
R1842:Mettl5 UTSW 2 69,715,686 (GRCm39) missense unknown
R1886:Mettl5 UTSW 2 69,711,149 (GRCm39) missense probably damaging 1.00
R2989:Mettl5 UTSW 2 69,711,659 (GRCm39) missense probably damaging 0.99
R4290:Mettl5 UTSW 2 69,711,176 (GRCm39) missense probably benign 0.00
R5646:Mettl5 UTSW 2 69,711,663 (GRCm39) nonsense probably null
R6313:Mettl5 UTSW 2 69,702,071 (GRCm39) splice site probably null
R9349:Mettl5 UTSW 2 69,702,113 (GRCm39) missense possibly damaging 0.87
R9623:Mettl5 UTSW 2 69,711,717 (GRCm39) missense possibly damaging 0.88
R9668:Mettl5 UTSW 2 69,711,723 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTGACTGAAGCCACTCCACATCC -3'
(R):5'- AGCCCCATATTATTTGGCAACCACTG -3'

Sequencing Primer
(F):5'- TGAAGCCACTCCACATCCAAATAG -3'
(R):5'- ggggggagagggtataggg -3'
Posted On 2014-02-11