Incidental Mutation 'R1370:Ism1'
ID 155921
Institutional Source Beutler Lab
Gene Symbol Ism1
Ensembl Gene ENSMUSG00000074766
Gene Name isthmin 1, angiogenesis inhibitor
Synonyms 5430433G21Rik
MMRRC Submission 039434-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.710) question?
Stock # R1370 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 139678178-139758581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139732074 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 115 (I115F)
Ref Sequence ENSEMBL: ENSMUSP00000139280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099307] [ENSMUST00000184404]
AlphaFold A2ATD1
Predicted Effect possibly damaging
Transcript: ENSMUST00000099307
AA Change: I108F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096910
Gene: ENSMUSG00000074766
AA Change: I108F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 165 177 N/A INTRINSIC
TSP1 210 252 3.69e-8 SMART
AMOP 279 442 5.38e-91 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000184404
AA Change: I115F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139280
Gene: ENSMUSG00000074766
AA Change: I115F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 172 184 N/A INTRINSIC
TSP1 217 259 3.69e-8 SMART
AMOP 286 449 5.38e-91 SMART
Meta Mutation Damage Score 0.3416 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adgra3 T C 5: 49,960,787 I1140V possibly damaging Het
Adrb3 A T 8: 27,227,770 probably null Het
Afap1 A G 5: 35,935,600 D16G unknown Het
AI593442 T C 9: 52,678,008 K90E probably damaging Het
Aicda A T 6: 122,561,185 N101Y probably benign Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
Bin1 A G 18: 32,429,703 I416V probably benign Het
Bptf A T 11: 107,047,094 S2724T probably damaging Het
Brf1 A T 12: 112,961,108 probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cdan1 A G 2: 120,719,139 probably null Het
Chaf1a A T 17: 56,064,032 H639L probably benign Het
Chd1 G A 17: 17,387,480 G430D probably benign Het
Clca3a2 T C 3: 144,813,863 probably benign Het
Clptm1 A G 7: 19,633,872 V605A possibly damaging Het
Cmpk2 A G 12: 26,471,452 D241G probably damaging Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dennd4c T A 4: 86,811,510 I783N probably damaging Het
Dock10 A G 1: 80,540,343 S1305P probably damaging Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Gbp8 C T 5: 105,016,576 A394T possibly damaging Het
Gm13023 T A 4: 143,795,304 L497I possibly damaging Het
H1fx A G 6: 87,981,151 I69T probably damaging Het
Herc2 T A 7: 56,168,873 C2771S probably benign Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Klk11 A G 7: 43,776,907 I22V probably benign Het
Krt6b T C 15: 101,677,552 D362G probably damaging Het
Lce1e A G 3: 92,707,843 S66P unknown Het
Letm1 A T 5: 33,778,682 probably null Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Mrpl12 A G 11: 120,485,301 S46G probably benign Het
Narfl A G 17: 25,776,988 E62G probably benign Het
Ndrg3 T C 2: 156,938,650 E198G probably damaging Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Pcdh20 A G 14: 88,468,301 I521T probably benign Het
Pdzph1 T C 17: 58,974,087 D400G possibly damaging Het
Per2 A T 1: 91,445,557 S170T possibly damaging Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rerg A T 6: 137,057,801 probably benign Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Sept2 G T 1: 93,499,106 V146L probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Sh3bp4 A T 1: 89,143,772 Y114F probably benign Het
Slc44a5 C A 3: 154,243,159 T188K probably benign Het
Slco6d1 A C 1: 98,423,094 I100L probably benign Het
Slfn4 G T 11: 83,188,806 D441Y probably damaging Het
Smg1 T C 7: 118,159,752 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Stard9 T C 2: 120,697,477 V1405A probably benign Het
Syt1 A G 10: 108,690,922 L42P probably damaging Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tbcel A T 9: 42,450,062 D63E probably damaging Het
Tdrd3 A T 14: 87,458,054 probably benign Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Tsc22d1 A G 14: 76,437,664 probably benign Het
Tsga10 G T 1: 37,835,453 T117K probably damaging Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Ttn G T 2: 76,847,151 probably benign Het
Wasf3 T C 5: 146,470,208 probably benign Het
Zbtb37 C T 1: 161,032,022 E238K probably benign Het
Zfp354c A G 11: 50,815,840 I136T probably benign Het
Zfp384 G A 6: 125,036,453 A479T probably benign Het
Zfp646 T A 7: 127,879,864 N404K probably damaging Het
Other mutations in Ism1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Ism1 APN 2 139757303 missense probably damaging 1.00
IGL02496:Ism1 APN 2 139757201 missense probably damaging 1.00
IGL03349:Ism1 APN 2 139731975 nonsense probably null
R0212:Ism1 UTSW 2 139740257 missense probably benign 0.00
R0312:Ism1 UTSW 2 139678672 start codon destroyed probably null 0.88
R1355:Ism1 UTSW 2 139732074 missense possibly damaging 0.93
R1775:Ism1 UTSW 2 139746043 missense probably damaging 1.00
R1992:Ism1 UTSW 2 139746017 missense probably benign 0.01
R2021:Ism1 UTSW 2 139740127 splice site probably null
R2035:Ism1 UTSW 2 139757155 missense probably damaging 1.00
R2270:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R2271:Ism1 UTSW 2 139757373 missense probably damaging 1.00
R3722:Ism1 UTSW 2 139732011 nonsense probably null
R3792:Ism1 UTSW 2 139740253 missense probably damaging 0.99
R4907:Ism1 UTSW 2 139678752 missense probably benign 0.27
R5621:Ism1 UTSW 2 139678721 missense probably damaging 0.99
R5964:Ism1 UTSW 2 139678757 missense probably benign
R6255:Ism1 UTSW 2 139746042 small deletion probably benign
R7009:Ism1 UTSW 2 139757279 missense probably damaging 1.00
R7325:Ism1 UTSW 2 139757043 missense probably damaging 1.00
R7851:Ism1 UTSW 2 139757265 missense probably damaging 1.00
R8851:Ism1 UTSW 2 139749545 missense probably damaging 1.00
R8958:Ism1 UTSW 2 139732075 missense possibly damaging 0.93
R9365:Ism1 UTSW 2 139740401 missense probably damaging 1.00
Z1176:Ism1 UTSW 2 139731874 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTTTCCTCTGTCCAAAGAAGCC -3'
(R):5'- GCTGCAATTTCAGGGTGCGTTAC -3'

Sequencing Primer
(F):5'- GTCCAAAGAAGCCCCGGAG -3'
(R):5'- CTCAGTGTCTCAAAAATAATGGTGG -3'
Posted On 2014-02-11