Incidental Mutation 'R1370:Ccdc39'
ID 155925
Institutional Source Beutler Lab
Gene Symbol Ccdc39
Ensembl Gene ENSMUSG00000027676
Gene Name coiled-coil domain containing 39
Synonyms b2b1735Clo, D3Ertd789e, prh, 4921507O14Rik, b2b1304Clo, b2b2025.1Clo
MMRRC Submission 039434-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.777) question?
Stock # R1370 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 33866511-33898459 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 33880629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 446 (K446R)
Ref Sequence ENSEMBL: ENSMUSP00000029222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029222]
AlphaFold Q9D5Y1
Predicted Effect probably damaging
Transcript: ENSMUST00000029222
AA Change: K446R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029222
Gene: ENSMUSG00000027676
AA Change: K446R

DomainStartEndE-ValueType
coiled coil region 16 67 N/A INTRINSIC
coiled coil region 164 198 N/A INTRINSIC
coiled coil region 232 339 N/A INTRINSIC
low complexity region 381 393 N/A INTRINSIC
internal_repeat_1 569 603 1.19e-5 PROSPERO
internal_repeat_1 598 635 1.19e-5 PROSPERO
coiled coil region 664 704 N/A INTRINSIC
coiled coil region 726 766 N/A INTRINSIC
low complexity region 873 889 N/A INTRINSIC
low complexity region 915 928 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200551
Meta Mutation Damage Score 0.1563 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the motility of cilia and flagella. The encoded protein is essential for the assembly of dynein regulatory and inner dynein arm complexes, which regulate ciliary beat. Defects in this gene are a cause of primary ciliary dyskinesia type 14 (CILD14). [provided by RefSeq, Jul 2011]
PHENOTYPE: ENU induced mutations result in situs inversus totalis with dextrocardia, double outlet right ventricle and atrial septal defects, renal anomalies including cysts and hydronephrosis, and immotile tracheal airway cilia. One ENU induced mutation causes ependymal motile cilia defects and hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Adgra3 T C 5: 50,118,129 (GRCm39) I1140V possibly damaging Het
Adrb3 A T 8: 27,717,798 (GRCm39) probably null Het
Afap1 A G 5: 36,092,944 (GRCm39) D16G unknown Het
AI593442 T C 9: 52,589,308 (GRCm39) K90E probably damaging Het
Aicda A T 6: 122,538,144 (GRCm39) N101Y probably benign Het
Alx1 A G 10: 102,864,353 (GRCm39) S39P possibly damaging Het
Ankrd52 A G 10: 128,224,565 (GRCm39) D781G possibly damaging Het
Arhgef5 T A 6: 43,260,846 (GRCm39) F1424I probably damaging Het
Atp10b G A 11: 43,042,482 (GRCm39) W14* probably null Het
Bin1 A G 18: 32,562,756 (GRCm39) I416V probably benign Het
Bptf A T 11: 106,937,920 (GRCm39) S2724T probably damaging Het
Brf1 A T 12: 112,924,728 (GRCm39) probably null Het
Cd226 T A 18: 89,265,147 (GRCm39) S29T probably benign Het
Cdan1 A G 2: 120,549,620 (GRCm39) probably null Het
Chaf1a A T 17: 56,371,032 (GRCm39) H639L probably benign Het
Chd1 G A 17: 17,607,742 (GRCm39) G430D probably benign Het
Ciao3 A G 17: 25,995,962 (GRCm39) E62G probably benign Het
Clca3a2 T C 3: 144,519,624 (GRCm39) probably benign Het
Clptm1 A G 7: 19,367,797 (GRCm39) V605A possibly damaging Het
Cmpk2 A G 12: 26,521,451 (GRCm39) D241G probably damaging Het
Cryzl1 A G 16: 91,489,546 (GRCm39) V266A possibly damaging Het
Cyp2c68 A G 19: 39,729,400 (GRCm39) L29P probably damaging Het
Dennd3 A C 15: 73,412,703 (GRCm39) probably benign Het
Dennd4c T A 4: 86,729,747 (GRCm39) I783N probably damaging Het
Dock10 A G 1: 80,518,060 (GRCm39) S1305P probably damaging Het
Eml6 T G 11: 29,783,085 (GRCm39) S599R probably benign Het
Gbp8 C T 5: 105,164,442 (GRCm39) A394T possibly damaging Het
H1f10 A G 6: 87,958,133 (GRCm39) I69T probably damaging Het
Herc2 T A 7: 55,818,621 (GRCm39) C2771S probably benign Het
Ism1 A T 2: 139,573,994 (GRCm39) I115F possibly damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itgb8 C T 12: 119,134,738 (GRCm39) G443E probably benign Het
Kalrn T A 16: 33,795,954 (GRCm39) I1274F possibly damaging Het
Klk1b11 A G 7: 43,426,331 (GRCm39) I22V probably benign Het
Krt6b T C 15: 101,585,987 (GRCm39) D362G probably damaging Het
Lce1e A G 3: 92,615,150 (GRCm39) S66P unknown Het
Letm1 A T 5: 33,936,026 (GRCm39) probably null Het
Lrrcc1 G T 3: 14,613,174 (GRCm39) V299L probably benign Het
Mettl5 A T 2: 69,711,764 (GRCm39) probably null Het
Mrpl12 A G 11: 120,376,127 (GRCm39) S46G probably benign Het
Ndrg3 T C 2: 156,780,570 (GRCm39) E198G probably damaging Het
Or5ac16 A G 16: 59,022,043 (GRCm39) S249P probably damaging Het
Pcdh20 A G 14: 88,705,737 (GRCm39) I521T probably benign Het
Pdzph1 T C 17: 59,281,082 (GRCm39) D400G possibly damaging Het
Per2 A T 1: 91,373,279 (GRCm39) S170T possibly damaging Het
Pramel25 T A 4: 143,521,874 (GRCm39) L497I possibly damaging Het
Pros1 A G 16: 62,739,921 (GRCm39) K457E probably benign Het
Rer1 T A 4: 155,160,081 (GRCm39) M156L probably benign Het
Rerg A T 6: 137,034,799 (GRCm39) probably benign Het
Sel1l3 G T 5: 53,357,559 (GRCm39) H144Q possibly damaging Het
Septin2 G T 1: 93,426,828 (GRCm39) V146L probably damaging Het
Setd1b C T 5: 123,298,748 (GRCm39) probably benign Het
Sh3bp4 A T 1: 89,071,494 (GRCm39) Y114F probably benign Het
Slc44a5 C A 3: 153,948,796 (GRCm39) T188K probably benign Het
Slco6d1 A C 1: 98,350,819 (GRCm39) I100L probably benign Het
Slfn4 G T 11: 83,079,632 (GRCm39) D441Y probably damaging Het
Smg1 T C 7: 117,758,975 (GRCm39) probably benign Het
Snrpb2 A G 2: 142,907,086 (GRCm39) probably benign Het
Sspo T A 6: 48,425,560 (GRCm39) S60R probably benign Het
Stard9 T C 2: 120,527,958 (GRCm39) V1405A probably benign Het
Syt1 A G 10: 108,526,783 (GRCm39) L42P probably damaging Het
Tarbp1 T C 8: 127,175,069 (GRCm39) D789G probably benign Het
Tbcel A T 9: 42,361,358 (GRCm39) D63E probably damaging Het
Tdrd3 A T 14: 87,695,490 (GRCm39) probably benign Het
Tiam1 A T 16: 89,695,109 (GRCm39) I116N probably benign Het
Tsc22d1 A G 14: 76,675,104 (GRCm39) probably benign Het
Tsga10 G T 1: 37,874,534 (GRCm39) T117K probably damaging Het
Ttc3 A G 16: 94,219,496 (GRCm39) S492G possibly damaging Het
Ttn G T 2: 76,677,495 (GRCm39) probably benign Het
Wasf3 T C 5: 146,407,018 (GRCm39) probably benign Het
Zbtb37 C T 1: 160,859,592 (GRCm39) E238K probably benign Het
Zfp354c A G 11: 50,706,667 (GRCm39) I136T probably benign Het
Zfp384 G A 6: 125,013,416 (GRCm39) A479T probably benign Het
Zfp646 T A 7: 127,479,036 (GRCm39) N404K probably damaging Het
Other mutations in Ccdc39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ccdc39 APN 3 33,886,717 (GRCm39) missense probably benign 0.16
IGL02321:Ccdc39 APN 3 33,871,107 (GRCm39) unclassified probably benign
IGL02426:Ccdc39 APN 3 33,879,547 (GRCm39) missense possibly damaging 0.85
IGL02930:Ccdc39 APN 3 33,879,643 (GRCm39) missense probably damaging 1.00
IGL03027:Ccdc39 APN 3 33,884,267 (GRCm39) missense probably benign 0.06
IGL03347:Ccdc39 APN 3 33,891,992 (GRCm39) missense probably damaging 1.00
R0046:Ccdc39 UTSW 3 33,898,301 (GRCm39) missense possibly damaging 0.52
R0046:Ccdc39 UTSW 3 33,898,301 (GRCm39) missense possibly damaging 0.52
R0601:Ccdc39 UTSW 3 33,873,988 (GRCm39) missense probably damaging 0.99
R0975:Ccdc39 UTSW 3 33,898,274 (GRCm39) missense probably damaging 1.00
R1075:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1224:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1251:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1252:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1254:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1255:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1331:Ccdc39 UTSW 3 33,869,634 (GRCm39) missense probably benign 0.34
R1385:Ccdc39 UTSW 3 33,875,561 (GRCm39) missense probably damaging 0.99
R1416:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1491:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1513:Ccdc39 UTSW 3 33,893,294 (GRCm39) missense possibly damaging 0.60
R1769:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1965:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R1966:Ccdc39 UTSW 3 33,880,629 (GRCm39) missense probably damaging 0.99
R2061:Ccdc39 UTSW 3 33,874,045 (GRCm39) missense probably damaging 0.97
R2109:Ccdc39 UTSW 3 33,869,650 (GRCm39) missense probably damaging 0.97
R2183:Ccdc39 UTSW 3 33,875,581 (GRCm39) missense possibly damaging 0.46
R2207:Ccdc39 UTSW 3 33,890,882 (GRCm39) missense probably damaging 0.97
R2208:Ccdc39 UTSW 3 33,895,327 (GRCm39) missense probably damaging 0.99
R2267:Ccdc39 UTSW 3 33,869,633 (GRCm39) missense probably damaging 0.99
R3012:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R3013:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R3120:Ccdc39 UTSW 3 33,891,987 (GRCm39) missense probably damaging 1.00
R3415:Ccdc39 UTSW 3 33,868,646 (GRCm39) missense probably benign 0.02
R3802:Ccdc39 UTSW 3 33,874,044 (GRCm39) missense probably damaging 1.00
R3804:Ccdc39 UTSW 3 33,874,044 (GRCm39) missense probably damaging 1.00
R4107:Ccdc39 UTSW 3 33,879,628 (GRCm39) missense probably damaging 1.00
R4334:Ccdc39 UTSW 3 33,892,031 (GRCm39) missense probably damaging 1.00
R4367:Ccdc39 UTSW 3 33,880,671 (GRCm39) missense probably benign 0.01
R4462:Ccdc39 UTSW 3 33,868,817 (GRCm39) missense probably damaging 1.00
R4653:Ccdc39 UTSW 3 33,873,955 (GRCm39) critical splice donor site probably null
R4723:Ccdc39 UTSW 3 33,867,227 (GRCm39) missense possibly damaging 0.66
R4908:Ccdc39 UTSW 3 33,893,242 (GRCm39) splice site probably null
R5236:Ccdc39 UTSW 3 33,884,251 (GRCm39) missense probably damaging 1.00
R5646:Ccdc39 UTSW 3 33,879,699 (GRCm39) missense probably damaging 1.00
R5705:Ccdc39 UTSW 3 33,871,086 (GRCm39) missense probably damaging 1.00
R5739:Ccdc39 UTSW 3 33,880,710 (GRCm39) missense possibly damaging 0.95
R6130:Ccdc39 UTSW 3 33,895,341 (GRCm39) splice site probably null
R6375:Ccdc39 UTSW 3 33,868,516 (GRCm39) missense probably benign 0.38
R6548:Ccdc39 UTSW 3 33,892,108 (GRCm39) missense probably benign 0.03
R6709:Ccdc39 UTSW 3 33,884,242 (GRCm39) missense possibly damaging 0.52
R6858:Ccdc39 UTSW 3 33,874,017 (GRCm39) missense probably damaging 1.00
R7183:Ccdc39 UTSW 3 33,868,620 (GRCm39) missense probably damaging 1.00
R7269:Ccdc39 UTSW 3 33,884,254 (GRCm39) missense probably benign 0.00
R7348:Ccdc39 UTSW 3 33,886,825 (GRCm39) missense possibly damaging 0.55
R7645:Ccdc39 UTSW 3 33,879,318 (GRCm39) splice site probably null
R7695:Ccdc39 UTSW 3 33,868,668 (GRCm39) missense probably damaging 1.00
R7752:Ccdc39 UTSW 3 33,886,766 (GRCm39) missense possibly damaging 0.55
R8487:Ccdc39 UTSW 3 33,886,808 (GRCm39) nonsense probably null
R8523:Ccdc39 UTSW 3 33,869,560 (GRCm39) critical splice donor site probably null
R8525:Ccdc39 UTSW 3 33,868,853 (GRCm39) missense probably benign 0.00
R8777:Ccdc39 UTSW 3 33,893,282 (GRCm39) missense probably benign
R8777-TAIL:Ccdc39 UTSW 3 33,893,282 (GRCm39) missense probably benign
R8842:Ccdc39 UTSW 3 33,880,612 (GRCm39) missense probably damaging 1.00
R8932:Ccdc39 UTSW 3 33,884,274 (GRCm39) missense probably benign 0.00
R8947:Ccdc39 UTSW 3 33,869,609 (GRCm39) unclassified probably benign
R9207:Ccdc39 UTSW 3 33,886,706 (GRCm39) nonsense probably null
R9280:Ccdc39 UTSW 3 33,870,153 (GRCm39) missense probably damaging 0.98
R9462:Ccdc39 UTSW 3 33,868,519 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCAGGTCCTTTAACACACAGTCC -3'
(R):5'- TGCCAACCTTGTCTACCAGCAC -3'

Sequencing Primer
(F):5'- ACAGTAGTAGCTTTTAAGACCCTCTC -3'
(R):5'- TTGTCTACCAGCACTGGAGATAAG -3'
Posted On 2014-02-11