Incidental Mutation 'R1370:Letm1'
ID155933
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Nameleucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 039434-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R1370 (G1)
Quality Score219
Status Validated
Chromosome5
Chromosomal Location33739673-33782817 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 33778682 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431] [ENSMUST00000148451]
Predicted Effect probably null
Transcript: ENSMUST00000005431
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000148451
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201981
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202183
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adgra3 T C 5: 49,960,787 I1140V possibly damaging Het
Adrb3 A T 8: 27,227,770 probably null Het
Afap1 A G 5: 35,935,600 D16G unknown Het
AI593442 T C 9: 52,678,008 K90E probably damaging Het
Aicda A T 6: 122,561,185 N101Y probably benign Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
Bin1 A G 18: 32,429,703 I416V probably benign Het
Bptf A T 11: 107,047,094 S2724T probably damaging Het
Brf1 A T 12: 112,961,108 probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cdan1 A G 2: 120,719,139 probably null Het
Chaf1a A T 17: 56,064,032 H639L probably benign Het
Chd1 G A 17: 17,387,480 G430D probably benign Het
Clca3a2 T C 3: 144,813,863 probably benign Het
Clptm1 A G 7: 19,633,872 V605A possibly damaging Het
Cmpk2 A G 12: 26,471,452 D241G probably damaging Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dennd4c T A 4: 86,811,510 I783N probably damaging Het
Dock10 A G 1: 80,540,343 S1305P probably damaging Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Gbp8 C T 5: 105,016,576 A394T possibly damaging Het
Gm13023 T A 4: 143,795,304 L497I possibly damaging Het
H1fx A G 6: 87,981,151 I69T probably damaging Het
Herc2 T A 7: 56,168,873 C2771S probably benign Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Klk11 A G 7: 43,776,907 I22V probably benign Het
Krt6b T C 15: 101,677,552 D362G probably damaging Het
Lce1e A G 3: 92,707,843 S66P unknown Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Mrpl12 A G 11: 120,485,301 S46G probably benign Het
Narfl A G 17: 25,776,988 E62G probably benign Het
Ndrg3 T C 2: 156,938,650 E198G probably damaging Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Pcdh20 A G 14: 88,468,301 I521T probably benign Het
Pdzph1 T C 17: 58,974,087 D400G possibly damaging Het
Per2 A T 1: 91,445,557 S170T possibly damaging Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rerg A T 6: 137,057,801 probably benign Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Sept2 G T 1: 93,499,106 V146L probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Sh3bp4 A T 1: 89,143,772 Y114F probably benign Het
Slc44a5 C A 3: 154,243,159 T188K probably benign Het
Slco6d1 A C 1: 98,423,094 I100L probably benign Het
Slfn4 G T 11: 83,188,806 D441Y probably damaging Het
Smg1 T C 7: 118,159,752 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Stard9 T C 2: 120,697,477 V1405A probably benign Het
Syt1 A G 10: 108,690,922 L42P probably damaging Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tbcel A T 9: 42,450,062 D63E probably damaging Het
Tdrd3 A T 14: 87,458,054 probably benign Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Tsc22d1 A G 14: 76,437,664 probably benign Het
Tsga10 G T 1: 37,835,453 T117K probably damaging Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Ttn G T 2: 76,847,151 probably benign Het
Wasf3 T C 5: 146,470,208 probably benign Het
Zbtb37 C T 1: 161,032,022 E238K probably benign Het
Zfp354c A G 11: 50,815,840 I136T probably benign Het
Zfp384 G A 6: 125,036,453 A479T probably benign Het
Zfp646 T A 7: 127,879,864 N404K probably damaging Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R2292:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
R8713:Letm1 UTSW 5 33762505 missense probably damaging 1.00
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGGAAGAAGCTGTCAGTTCCC -3'
(R):5'- TGCCAGCAACTGTAGCTGGAAAG -3'

Sequencing Primer
(F):5'- TTCCCTGACAAAGTCCAGGTG -3'
(R):5'- GAGAGCCCACCTTCCTCAG -3'
Posted On2014-02-11