Mutagenetix > Incidental Mutation

Incidental Mutation 'R1370:Arhgef5'

155940

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

039434-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1370 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43283912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1424 (F1424I)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: F1424I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: F1424I

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182752

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183313

Meta Mutation Damage Score

0.2964

Coding Region Coverage

1x: 98.7%
3x: 97.5%
10x: 93.6%
20x: 84.8%

Validation Efficiency

99% (80/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb10	C	T	8: 123,962,052	G495D	probably damaging	Het
Adgra3	T	C	5: 49,960,787	I1140V	possibly damaging	Het
Adrb3	A	T	8: 27,227,770		probably null	Het
Afap1	A	G	5: 35,935,600	D16G	unknown	Het
AI593442	T	C	9: 52,678,008	K90E	probably damaging	Het
Aicda	A	T	6: 122,561,185	N101Y	probably benign	Het
Alx1	A	G	10: 103,028,492	S39P	possibly damaging	Het
Ankrd52	A	G	10: 128,388,696	D781G	possibly damaging	Het
Atp10b	G	A	11: 43,151,655	W14*	probably null	Het
Bin1	A	G	18: 32,429,703	I416V	probably benign	Het
Bptf	A	T	11: 107,047,094	S2724T	probably damaging	Het
Brf1	A	T	12: 112,961,108		probably null	Het
Ccdc39	T	C	3: 33,826,480	K446R	probably damaging	Het
Cd226	T	A	18: 89,247,023	S29T	probably benign	Het
Cdan1	A	G	2: 120,719,139		probably null	Het
Chaf1a	A	T	17: 56,064,032	H639L	probably benign	Het
Chd1	G	A	17: 17,387,480	G430D	probably benign	Het
Clca3a2	T	C	3: 144,813,863		probably benign	Het
Clptm1	A	G	7: 19,633,872	V605A	possibly damaging	Het
Cmpk2	A	G	12: 26,471,452	D241G	probably damaging	Het
Cryzl1	A	G	16: 91,692,658	V266A	possibly damaging	Het
Cyp2c68	A	G	19: 39,740,956	L29P	probably damaging	Het
Dennd3	A	C	15: 73,540,854		probably benign	Het
Dennd4c	T	A	4: 86,811,510	I783N	probably damaging	Het
Dock10	A	G	1: 80,540,343	S1305P	probably damaging	Het
Eml6	T	G	11: 29,833,085	S599R	probably benign	Het
Gbp8	C	T	5: 105,016,576	A394T	possibly damaging	Het
Gm13023	T	A	4: 143,795,304	L497I	possibly damaging	Het
H1fx	A	G	6: 87,981,151	I69T	probably damaging	Het
Herc2	T	A	7: 56,168,873	C2771S	probably benign	Het
Ism1	A	T	2: 139,732,074	I115F	possibly damaging	Het
Itga10	C	T	3: 96,651,738		probably benign	Het
Itgb8	C	T	12: 119,171,003	G443E	probably benign	Het
Kalrn	T	A	16: 33,975,584	I1274F	possibly damaging	Het
Klk11	A	G	7: 43,776,907	I22V	probably benign	Het
Krt6b	T	C	15: 101,677,552	D362G	probably damaging	Het
Lce1e	A	G	3: 92,707,843	S66P	unknown	Het
Letm1	A	T	5: 33,778,682		probably null	Het
Lrrcc1	G	T	3: 14,548,114	V299L	probably benign	Het
Mettl5	A	T	2: 69,881,420		probably null	Het
Mrpl12	A	G	11: 120,485,301	S46G	probably benign	Het
Narfl	A	G	17: 25,776,988	E62G	probably benign	Het
Ndrg3	T	C	2: 156,938,650	E198G	probably damaging	Het
Olfr198	A	G	16: 59,201,680	S249P	probably damaging	Het
Pcdh20	A	G	14: 88,468,301	I521T	probably benign	Het
Pdzph1	T	C	17: 58,974,087	D400G	possibly damaging	Het
Per2	A	T	1: 91,445,557	S170T	possibly damaging	Het
Pros1	A	G	16: 62,919,558	K457E	probably benign	Het
Rer1	T	A	4: 155,075,624	M156L	probably benign	Het
Rerg	A	T	6: 137,057,801		probably benign	Het
Sel1l3	G	T	5: 53,200,217	H144Q	possibly damaging	Het
Sept2	G	T	1: 93,499,106	V146L	probably damaging	Het
Setd1b	C	T	5: 123,160,685		probably benign	Het
Sh3bp4	A	T	1: 89,143,772	Y114F	probably benign	Het
Slc44a5	C	A	3: 154,243,159	T188K	probably benign	Het
Slco6d1	A	C	1: 98,423,094	I100L	probably benign	Het
Slfn4	G	T	11: 83,188,806	D441Y	probably damaging	Het
Smg1	T	C	7: 118,159,752		probably benign	Het
Snrpb2	A	G	2: 143,065,166		probably benign	Het
Sspo	T	A	6: 48,448,626	S60R	probably benign	Het
Stard9	T	C	2: 120,697,477	V1405A	probably benign	Het
Syt1	A	G	10: 108,690,922	L42P	probably damaging	Het
Tarbp1	T	C	8: 126,448,330	D789G	probably benign	Het
Tbcel	A	T	9: 42,450,062	D63E	probably damaging	Het
Tdrd3	A	T	14: 87,458,054		probably benign	Het
Tiam1	A	T	16: 89,898,221	I116N	probably benign	Het
Tsc22d1	A	G	14: 76,437,664		probably benign	Het
Tsga10	G	T	1: 37,835,453	T117K	probably damaging	Het
Ttc3	A	G	16: 94,418,637	S492G	possibly damaging	Het
Ttn	G	T	2: 76,847,151		probably benign	Het
Wasf3	T	C	5: 146,470,208		probably benign	Het
Zbtb37	C	T	1: 161,032,022	E238K	probably benign	Het
Zfp354c	A	G	11: 50,815,840	I136T	probably benign	Het
Zfp384	G	A	6: 125,036,453	A479T	probably benign	Het
Zfp646	T	A	7: 127,879,864	N404K	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
R9685:Arhgef5	UTSW	6	43273593	missense	probably benign	0.11
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GGACATCAAATGACCTGCTGCCAAG -3'
(R):5'- ATGGTTCTGACCAGGGACATCCAC -3'

Sequencing Primer
(F):5'- ACTCACAGTCTGAGTCATGAGTC -3'
(R):5'- ACCCCCAACTCCTGTGTC -3'

Posted On

2014-02-11