Incidental Mutation 'R1370:Clptm1'
ID 155946
Institutional Source Beutler Lab
Gene Symbol Clptm1
Ensembl Gene ENSMUSG00000002981
Gene Name cleft lip and palate associated transmembrane protein 1
Synonyms N14, HS9
MMRRC Submission 039434-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.943) question?
Stock # R1370 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19631571-19665033 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19633872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 605 (V605A)
Ref Sequence ENSEMBL: ENSMUSP00000051293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049912] [ENSMUST00000055242] [ENSMUST00000094762] [ENSMUST00000098754] [ENSMUST00000208087]
AlphaFold Q8VBZ3
Predicted Effect probably benign
Transcript: ENSMUST00000049912
SMART Domains Protein: ENSMUSP00000050166
Gene: ENSMUSG00000002983

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 73 82 N/A INTRINSIC
Pfam:RHD 102 270 1.3e-65 PFAM
IPT 277 373 1.26e-24 SMART
low complexity region 449 464 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055242
AA Change: V605A

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051293
Gene: ENSMUSG00000002981
AA Change: V605A

DomainStartEndE-ValueType
low complexity region 2 23 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Pfam:CLPTM1 56 497 5.8e-148 PFAM
transmembrane domain 507 529 N/A INTRINSIC
low complexity region 606 628 N/A INTRINSIC
low complexity region 649 664 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094762
SMART Domains Protein: ENSMUSP00000092355
Gene: ENSMUSG00000002983

DomainStartEndE-ValueType
Pfam:RelB_leu_zip 1 84 1.2e-43 PFAM
Pfam:RHD_DNA_bind 105 273 3.7e-66 PFAM
IPT 280 376 1.26e-24 SMART
Pfam:RelB_transactiv 381 558 3.2e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098754
SMART Domains Protein: ENSMUSP00000096350
Gene: ENSMUSG00000002983

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
Pfam:RHD 105 273 3.7e-66 PFAM
IPT 280 376 1.26e-24 SMART
low complexity region 452 467 N/A INTRINSIC
low complexity region 481 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207704
Predicted Effect probably benign
Transcript: ENSMUST00000208087
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208868
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 123,962,052 G495D probably damaging Het
Adgra3 T C 5: 49,960,787 I1140V possibly damaging Het
Adrb3 A T 8: 27,227,770 probably null Het
Afap1 A G 5: 35,935,600 D16G unknown Het
AI593442 T C 9: 52,678,008 K90E probably damaging Het
Aicda A T 6: 122,561,185 N101Y probably benign Het
Alx1 A G 10: 103,028,492 S39P possibly damaging Het
Ankrd52 A G 10: 128,388,696 D781G possibly damaging Het
Arhgef5 T A 6: 43,283,912 F1424I probably damaging Het
Atp10b G A 11: 43,151,655 W14* probably null Het
Bin1 A G 18: 32,429,703 I416V probably benign Het
Bptf A T 11: 107,047,094 S2724T probably damaging Het
Brf1 A T 12: 112,961,108 probably null Het
Ccdc39 T C 3: 33,826,480 K446R probably damaging Het
Cd226 T A 18: 89,247,023 S29T probably benign Het
Cdan1 A G 2: 120,719,139 probably null Het
Chaf1a A T 17: 56,064,032 H639L probably benign Het
Chd1 G A 17: 17,387,480 G430D probably benign Het
Clca3a2 T C 3: 144,813,863 probably benign Het
Cmpk2 A G 12: 26,471,452 D241G probably damaging Het
Cryzl1 A G 16: 91,692,658 V266A possibly damaging Het
Cyp2c68 A G 19: 39,740,956 L29P probably damaging Het
Dennd3 A C 15: 73,540,854 probably benign Het
Dennd4c T A 4: 86,811,510 I783N probably damaging Het
Dock10 A G 1: 80,540,343 S1305P probably damaging Het
Eml6 T G 11: 29,833,085 S599R probably benign Het
Gbp8 C T 5: 105,016,576 A394T possibly damaging Het
Gm13023 T A 4: 143,795,304 L497I possibly damaging Het
H1fx A G 6: 87,981,151 I69T probably damaging Het
Herc2 T A 7: 56,168,873 C2771S probably benign Het
Ism1 A T 2: 139,732,074 I115F possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Itgb8 C T 12: 119,171,003 G443E probably benign Het
Kalrn T A 16: 33,975,584 I1274F possibly damaging Het
Klk11 A G 7: 43,776,907 I22V probably benign Het
Krt6b T C 15: 101,677,552 D362G probably damaging Het
Lce1e A G 3: 92,707,843 S66P unknown Het
Letm1 A T 5: 33,778,682 probably null Het
Lrrcc1 G T 3: 14,548,114 V299L probably benign Het
Mettl5 A T 2: 69,881,420 probably null Het
Mrpl12 A G 11: 120,485,301 S46G probably benign Het
Narfl A G 17: 25,776,988 E62G probably benign Het
Ndrg3 T C 2: 156,938,650 E198G probably damaging Het
Olfr198 A G 16: 59,201,680 S249P probably damaging Het
Pcdh20 A G 14: 88,468,301 I521T probably benign Het
Pdzph1 T C 17: 58,974,087 D400G possibly damaging Het
Per2 A T 1: 91,445,557 S170T possibly damaging Het
Pros1 A G 16: 62,919,558 K457E probably benign Het
Rer1 T A 4: 155,075,624 M156L probably benign Het
Rerg A T 6: 137,057,801 probably benign Het
Sel1l3 G T 5: 53,200,217 H144Q possibly damaging Het
Sept2 G T 1: 93,499,106 V146L probably damaging Het
Setd1b C T 5: 123,160,685 probably benign Het
Sh3bp4 A T 1: 89,143,772 Y114F probably benign Het
Slc44a5 C A 3: 154,243,159 T188K probably benign Het
Slco6d1 A C 1: 98,423,094 I100L probably benign Het
Slfn4 G T 11: 83,188,806 D441Y probably damaging Het
Smg1 T C 7: 118,159,752 probably benign Het
Snrpb2 A G 2: 143,065,166 probably benign Het
Sspo T A 6: 48,448,626 S60R probably benign Het
Stard9 T C 2: 120,697,477 V1405A probably benign Het
Syt1 A G 10: 108,690,922 L42P probably damaging Het
Tarbp1 T C 8: 126,448,330 D789G probably benign Het
Tbcel A T 9: 42,450,062 D63E probably damaging Het
Tdrd3 A T 14: 87,458,054 probably benign Het
Tiam1 A T 16: 89,898,221 I116N probably benign Het
Tsc22d1 A G 14: 76,437,664 probably benign Het
Tsga10 G T 1: 37,835,453 T117K probably damaging Het
Ttc3 A G 16: 94,418,637 S492G possibly damaging Het
Ttn G T 2: 76,847,151 probably benign Het
Wasf3 T C 5: 146,470,208 probably benign Het
Zbtb37 C T 1: 161,032,022 E238K probably benign Het
Zfp354c A G 11: 50,815,840 I136T probably benign Het
Zfp384 G A 6: 125,036,453 A479T probably benign Het
Zfp646 T A 7: 127,879,864 N404K probably damaging Het
Other mutations in Clptm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01614:Clptm1 APN 7 19637700 missense probably benign 0.14
IGL01909:Clptm1 APN 7 19655776 missense probably benign 0.37
IGL03089:Clptm1 APN 7 19637147 missense probably damaging 1.00
H8786:Clptm1 UTSW 7 19635704 missense possibly damaging 0.54
R0128:Clptm1 UTSW 7 19635007 missense probably damaging 1.00
R0835:Clptm1 UTSW 7 19635674 missense possibly damaging 0.61
R1167:Clptm1 UTSW 7 19634211 missense probably damaging 1.00
R1655:Clptm1 UTSW 7 19645867 missense probably benign 0.00
R1855:Clptm1 UTSW 7 19638209 missense probably benign 0.05
R2004:Clptm1 UTSW 7 19646837 missense possibly damaging 0.46
R2189:Clptm1 UTSW 7 19637145 nonsense probably null
R2203:Clptm1 UTSW 7 19633892 missense possibly damaging 0.92
R3237:Clptm1 UTSW 7 19635346 missense probably damaging 0.99
R3963:Clptm1 UTSW 7 19638196 nonsense probably null
R5416:Clptm1 UTSW 7 19633816 unclassified probably benign
R6110:Clptm1 UTSW 7 19633806 unclassified probably benign
R6474:Clptm1 UTSW 7 19635837 missense possibly damaging 0.94
R6737:Clptm1 UTSW 7 19637076 critical splice donor site probably null
R6897:Clptm1 UTSW 7 19635826 missense possibly damaging 0.94
R8144:Clptm1 UTSW 7 19633902 missense possibly damaging 0.88
R8244:Clptm1 UTSW 7 19638991 missense possibly damaging 0.46
R8374:Clptm1 UTSW 7 19638156 missense probably benign 0.13
R8438:Clptm1 UTSW 7 19645851 missense probably benign 0.00
R8885:Clptm1 UTSW 7 19639007 missense probably damaging 1.00
R9399:Clptm1 UTSW 7 19633917 missense probably damaging 1.00
R9467:Clptm1 UTSW 7 19637524 missense probably benign 0.04
R9529:Clptm1 UTSW 7 19637675 missense probably benign 0.17
Z1177:Clptm1 UTSW 7 19637468 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTCAGTCACCAGGAGCAGATAAG -3'
(R):5'- AATGCAACGATCTGGGGTAGGC -3'

Sequencing Primer
(F):5'- GCAGTGGCTAATCCTTTTTCTTG -3'
(R):5'- AAGATGCCTGTCATGTACCG -3'
Posted On 2014-02-11