Incidental Mutation 'R1370:Zfp646'
ID 155950
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Name zinc finger protein 646
Synonyms
MMRRC Submission 039434-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R1370 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 127476081-127485168 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 127479036 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 404 (N404K)
Ref Sequence ENSEMBL: ENSMUSP00000115499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000054415] [ENSMUST00000106261] [ENSMUST00000106262] [ENSMUST00000106263] [ENSMUST00000131000] [ENSMUST00000144721]
AlphaFold Q6NV66
Predicted Effect probably damaging
Transcript: ENSMUST00000050383
AA Change: N404K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: N404K

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054415
SMART Domains Protein: ENSMUSP00000056105
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106261
SMART Domains Protein: ENSMUSP00000101868
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106262
SMART Domains Protein: ENSMUSP00000101869
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106263
SMART Domains Protein: ENSMUSP00000101870
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131000
AA Change: N404K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739
AA Change: N404K

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144721
SMART Domains Protein: ENSMUSP00000116730
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
Predicted Effect unknown
Transcript: ENSMUST00000206340
AA Change: N184K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205364
Meta Mutation Damage Score 0.5783 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.5%
  • 10x: 93.6%
  • 20x: 84.8%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb10 C T 8: 124,688,791 (GRCm39) G495D probably damaging Het
Adgra3 T C 5: 50,118,129 (GRCm39) I1140V possibly damaging Het
Adrb3 A T 8: 27,717,798 (GRCm39) probably null Het
Afap1 A G 5: 36,092,944 (GRCm39) D16G unknown Het
AI593442 T C 9: 52,589,308 (GRCm39) K90E probably damaging Het
Aicda A T 6: 122,538,144 (GRCm39) N101Y probably benign Het
Alx1 A G 10: 102,864,353 (GRCm39) S39P possibly damaging Het
Ankrd52 A G 10: 128,224,565 (GRCm39) D781G possibly damaging Het
Arhgef5 T A 6: 43,260,846 (GRCm39) F1424I probably damaging Het
Atp10b G A 11: 43,042,482 (GRCm39) W14* probably null Het
Bin1 A G 18: 32,562,756 (GRCm39) I416V probably benign Het
Bptf A T 11: 106,937,920 (GRCm39) S2724T probably damaging Het
Brf1 A T 12: 112,924,728 (GRCm39) probably null Het
Ccdc39 T C 3: 33,880,629 (GRCm39) K446R probably damaging Het
Cd226 T A 18: 89,265,147 (GRCm39) S29T probably benign Het
Cdan1 A G 2: 120,549,620 (GRCm39) probably null Het
Chaf1a A T 17: 56,371,032 (GRCm39) H639L probably benign Het
Chd1 G A 17: 17,607,742 (GRCm39) G430D probably benign Het
Ciao3 A G 17: 25,995,962 (GRCm39) E62G probably benign Het
Clca3a2 T C 3: 144,519,624 (GRCm39) probably benign Het
Clptm1 A G 7: 19,367,797 (GRCm39) V605A possibly damaging Het
Cmpk2 A G 12: 26,521,451 (GRCm39) D241G probably damaging Het
Cryzl1 A G 16: 91,489,546 (GRCm39) V266A possibly damaging Het
Cyp2c68 A G 19: 39,729,400 (GRCm39) L29P probably damaging Het
Dennd3 A C 15: 73,412,703 (GRCm39) probably benign Het
Dennd4c T A 4: 86,729,747 (GRCm39) I783N probably damaging Het
Dock10 A G 1: 80,518,060 (GRCm39) S1305P probably damaging Het
Eml6 T G 11: 29,783,085 (GRCm39) S599R probably benign Het
Gbp8 C T 5: 105,164,442 (GRCm39) A394T possibly damaging Het
H1f10 A G 6: 87,958,133 (GRCm39) I69T probably damaging Het
Herc2 T A 7: 55,818,621 (GRCm39) C2771S probably benign Het
Ism1 A T 2: 139,573,994 (GRCm39) I115F possibly damaging Het
Itga10 C T 3: 96,559,054 (GRCm39) probably benign Het
Itgb8 C T 12: 119,134,738 (GRCm39) G443E probably benign Het
Kalrn T A 16: 33,795,954 (GRCm39) I1274F possibly damaging Het
Klk1b11 A G 7: 43,426,331 (GRCm39) I22V probably benign Het
Krt6b T C 15: 101,585,987 (GRCm39) D362G probably damaging Het
Lce1e A G 3: 92,615,150 (GRCm39) S66P unknown Het
Letm1 A T 5: 33,936,026 (GRCm39) probably null Het
Lrrcc1 G T 3: 14,613,174 (GRCm39) V299L probably benign Het
Mettl5 A T 2: 69,711,764 (GRCm39) probably null Het
Mrpl12 A G 11: 120,376,127 (GRCm39) S46G probably benign Het
Ndrg3 T C 2: 156,780,570 (GRCm39) E198G probably damaging Het
Or5ac16 A G 16: 59,022,043 (GRCm39) S249P probably damaging Het
Pcdh20 A G 14: 88,705,737 (GRCm39) I521T probably benign Het
Pdzph1 T C 17: 59,281,082 (GRCm39) D400G possibly damaging Het
Per2 A T 1: 91,373,279 (GRCm39) S170T possibly damaging Het
Pramel25 T A 4: 143,521,874 (GRCm39) L497I possibly damaging Het
Pros1 A G 16: 62,739,921 (GRCm39) K457E probably benign Het
Rer1 T A 4: 155,160,081 (GRCm39) M156L probably benign Het
Rerg A T 6: 137,034,799 (GRCm39) probably benign Het
Sel1l3 G T 5: 53,357,559 (GRCm39) H144Q possibly damaging Het
Septin2 G T 1: 93,426,828 (GRCm39) V146L probably damaging Het
Setd1b C T 5: 123,298,748 (GRCm39) probably benign Het
Sh3bp4 A T 1: 89,071,494 (GRCm39) Y114F probably benign Het
Slc44a5 C A 3: 153,948,796 (GRCm39) T188K probably benign Het
Slco6d1 A C 1: 98,350,819 (GRCm39) I100L probably benign Het
Slfn4 G T 11: 83,079,632 (GRCm39) D441Y probably damaging Het
Smg1 T C 7: 117,758,975 (GRCm39) probably benign Het
Snrpb2 A G 2: 142,907,086 (GRCm39) probably benign Het
Sspo T A 6: 48,425,560 (GRCm39) S60R probably benign Het
Stard9 T C 2: 120,527,958 (GRCm39) V1405A probably benign Het
Syt1 A G 10: 108,526,783 (GRCm39) L42P probably damaging Het
Tarbp1 T C 8: 127,175,069 (GRCm39) D789G probably benign Het
Tbcel A T 9: 42,361,358 (GRCm39) D63E probably damaging Het
Tdrd3 A T 14: 87,695,490 (GRCm39) probably benign Het
Tiam1 A T 16: 89,695,109 (GRCm39) I116N probably benign Het
Tsc22d1 A G 14: 76,675,104 (GRCm39) probably benign Het
Tsga10 G T 1: 37,874,534 (GRCm39) T117K probably damaging Het
Ttc3 A G 16: 94,219,496 (GRCm39) S492G possibly damaging Het
Ttn G T 2: 76,677,495 (GRCm39) probably benign Het
Wasf3 T C 5: 146,407,018 (GRCm39) probably benign Het
Zbtb37 C T 1: 160,859,592 (GRCm39) E238K probably benign Het
Zfp354c A G 11: 50,706,667 (GRCm39) I136T probably benign Het
Zfp384 G A 6: 125,013,416 (GRCm39) A479T probably benign Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127,478,302 (GRCm39) missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127,478,137 (GRCm39) missense probably benign
IGL02571:Zfp646 APN 7 127,478,584 (GRCm39) missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127,479,903 (GRCm39) missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127,480,476 (GRCm39) missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127,482,678 (GRCm39) missense probably benign 0.41
R0394:Zfp646 UTSW 7 127,482,434 (GRCm39) missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127,481,138 (GRCm39) missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127,482,982 (GRCm39) nonsense probably null
R0930:Zfp646 UTSW 7 127,482,982 (GRCm39) nonsense probably null
R1219:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1221:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1351:Zfp646 UTSW 7 127,482,683 (GRCm39) missense probably benign
R1503:Zfp646 UTSW 7 127,479,308 (GRCm39) missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127,479,359 (GRCm39) splice site probably null
R1817:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1818:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1819:Zfp646 UTSW 7 127,482,292 (GRCm39) missense probably benign
R1838:Zfp646 UTSW 7 127,478,911 (GRCm39) missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127,483,021 (GRCm39) missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127,481,359 (GRCm39) missense probably damaging 1.00
R2763:Zfp646 UTSW 7 127,479,210 (GRCm39) nonsense probably null
R4346:Zfp646 UTSW 7 127,478,681 (GRCm39) missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127,482,649 (GRCm39) missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127,482,907 (GRCm39) missense probably benign 0.00
R4936:Zfp646 UTSW 7 127,480,933 (GRCm39) missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127,478,354 (GRCm39) missense probably benign 0.01
R5062:Zfp646 UTSW 7 127,479,671 (GRCm39) missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127,481,875 (GRCm39) missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127,478,530 (GRCm39) missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127,484,626 (GRCm39) missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127,478,190 (GRCm39) missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127,477,897 (GRCm39) missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127,483,079 (GRCm39) missense probably benign 0.13
R6331:Zfp646 UTSW 7 127,482,853 (GRCm39) missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127,479,113 (GRCm39) missense probably benign 0.00
R6814:Zfp646 UTSW 7 127,482,505 (GRCm39) missense probably benign 0.17
R6872:Zfp646 UTSW 7 127,482,505 (GRCm39) missense probably benign 0.17
R6903:Zfp646 UTSW 7 127,479,892 (GRCm39) missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127,481,494 (GRCm39) missense probably benign
R7049:Zfp646 UTSW 7 127,479,199 (GRCm39) missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127,478,944 (GRCm39) missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127,477,968 (GRCm39) nonsense probably null
R8345:Zfp646 UTSW 7 127,483,082 (GRCm39) missense probably benign 0.12
R8545:Zfp646 UTSW 7 127,484,662 (GRCm39) missense probably benign
R8909:Zfp646 UTSW 7 127,478,515 (GRCm39) missense probably damaging 0.99
R8983:Zfp646 UTSW 7 127,480,777 (GRCm39) missense probably benign
R9001:Zfp646 UTSW 7 127,478,856 (GRCm39) missense probably damaging 0.96
R9018:Zfp646 UTSW 7 127,478,243 (GRCm39) missense probably benign
R9118:Zfp646 UTSW 7 127,480,810 (GRCm39) missense
R9414:Zfp646 UTSW 7 127,481,050 (GRCm39) missense probably damaging 0.99
Z1177:Zfp646 UTSW 7 127,479,804 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CTGGAACATCAGCAGTCCCATGAG -3'
(R):5'- TAGCCTTGCAATGTACCCGCAC -3'

Sequencing Primer
(F):5'- TTGGGGTCAGCTATCTAAAACAG -3'
(R):5'- AATGTACCCGCACATGGTTG -3'
Posted On 2014-02-11