Incidental Mutation 'R1365:Dars2'
ID155988
Institutional Source Beutler Lab
Gene Symbol Dars2
Ensembl Gene ENSMUSG00000026709
Gene Nameaspartyl-tRNA synthetase 2 (mitochondrial)
Synonyms5830468K18Rik
MMRRC Submission 039430-MU
Accession Numbers

Ncbi RefSeq: NM_172644.3; MGI: 2442510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1365 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location161040601-161070658 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 161044994 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 546 (Q546*)
Ref Sequence ENSEMBL: ENSMUSP00000041851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035430]
Predicted Effect probably null
Transcript: ENSMUST00000035430
AA Change: Q546*
SMART Domains Protein: ENSMUSP00000041851
Gene: ENSMUSG00000026709
AA Change: Q546*

DomainStartEndE-ValueType
Pfam:tRNA_anti-codon 65 148 7e-10 PFAM
Pfam:tRNA-synt_2 165 607 1.2e-90 PFAM
Pfam:GAD 355 451 2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195700
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. It is a mitochondrial enzyme that specifically aminoacylates aspartyl-tRNA. Mutations in this gene are associated with leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). [provided by RefSeq, Nov 2009]
Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 G A 13: 98,075,124 T117M probably damaging Het
Asb15 T C 6: 24,567,270 I530T possibly damaging Het
Brca1 T C 11: 101,501,996 N1673S probably benign Het
Cd48 A T 1: 171,699,561 Q185L probably damaging Het
Cog2 A T 8: 124,540,974 K343I probably damaging Het
Dst A G 1: 34,188,194 K1623E probably benign Het
Epn1 G A 7: 5,093,370 R221Q probably benign Het
Gtf2b T C 3: 142,771,466 I33T probably damaging Het
Hsf4 G T 8: 105,271,094 R156L probably damaging Het
Itch A G 2: 155,213,031 N752D probably benign Het
Kif28 G A 1: 179,739,987 Q73* probably null Het
Mamdc4 T C 2: 25,566,024 Y790C probably damaging Het
Med1 T C 11: 98,155,995 probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nf1 A G 11: 79,547,885 probably null Het
Oxct2b G A 4: 123,117,369 V361I probably benign Het
Pid1 T C 1: 84,038,141 M168V probably damaging Het
Plk1 A G 7: 122,168,629 D419G probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sem1 T C 6: 6,560,501 D26G possibly damaging Het
Sin3a C T 9: 57,125,203 R1141* probably null Het
Slf1 C T 13: 77,126,371 A68T probably damaging Het
Trmo A G 4: 46,380,278 S364P probably damaging Het
Uchl3 A G 14: 101,654,092 E10G probably damaging Het
Usp14 C T 18: 10,000,490 probably null Het
Vmn1r203 T A 13: 22,524,586 M179K probably benign Het
Vps13a A G 19: 16,619,446 Y3103H probably damaging Het
Zfp804a T C 2: 82,257,246 L473P probably benign Het
Zfp979 A T 4: 147,613,224 Y343N probably benign Het
Other mutations in Dars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
P0005:Dars2 UTSW 1 161053939 critical splice donor site probably null
R0230:Dars2 UTSW 1 161062787 missense probably benign 0.02
R0537:Dars2 UTSW 1 161060748 missense possibly damaging 0.46
R0709:Dars2 UTSW 1 161046928 missense probably benign 0.00
R1502:Dars2 UTSW 1 161046805 nonsense probably null
R1625:Dars2 UTSW 1 161054044 missense possibly damaging 0.88
R1934:Dars2 UTSW 1 161063241 splice site probably null
R2239:Dars2 UTSW 1 161063282 missense possibly damaging 0.83
R3721:Dars2 UTSW 1 161063308 missense probably benign 0.03
R4308:Dars2 UTSW 1 161041721 missense probably damaging 0.98
R4786:Dars2 UTSW 1 161060760 missense probably damaging 1.00
R4859:Dars2 UTSW 1 161044990 missense probably damaging 0.99
R4903:Dars2 UTSW 1 161051371 missense probably benign 0.06
R5042:Dars2 UTSW 1 161045094 intron probably benign
R5068:Dars2 UTSW 1 161041913 missense probably benign 0.02
R6257:Dars2 UTSW 1 161041828 missense probably damaging 1.00
R7286:Dars2 UTSW 1 161046808 missense possibly damaging 0.85
R7346:Dars2 UTSW 1 161046772 splice site probably null
R7444:Dars2 UTSW 1 161046884 missense possibly damaging 0.94
R7593:Dars2 UTSW 1 161057543 missense probably damaging 1.00
R7845:Dars2 UTSW 1 161041748 missense probably benign 0.00
X0063:Dars2 UTSW 1 161056493 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- AGATAGTCCCTGGCACCCAGTAAG -3'
(R):5'- GCTCCTAACTCCAGTGACATTCACC -3'

Sequencing Primer
(F):5'- tcagaaatccgcctgcc -3'
(R):5'- TCTGGATTCCCTCAGGAGAAC -3'
Posted On2014-02-11