Incidental Mutation 'R1365:Mamdc4'
ID155991
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
MMRRC Submission 039430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R1365 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 25566024 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 790 (Y790C)
Ref Sequence ENSEMBL: ENSMUSP00000092735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095117
AA Change: Y790C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: Y790C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114223
AA Change: Y786C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: Y786C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152124
Predicted Effect unknown
Transcript: ENSMUST00000152237
AA Change: Y687C
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941
AA Change: Y687C

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153008
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 G A 13: 98,075,124 T117M probably damaging Het
Asb15 T C 6: 24,567,270 I530T possibly damaging Het
Brca1 T C 11: 101,501,996 N1673S probably benign Het
Cd48 A T 1: 171,699,561 Q185L probably damaging Het
Cog2 A T 8: 124,540,974 K343I probably damaging Het
Dars2 G A 1: 161,044,994 Q546* probably null Het
Dst A G 1: 34,188,194 K1623E probably benign Het
Epn1 G A 7: 5,093,370 R221Q probably benign Het
Gtf2b T C 3: 142,771,466 I33T probably damaging Het
Hsf4 G T 8: 105,271,094 R156L probably damaging Het
Itch A G 2: 155,213,031 N752D probably benign Het
Kif28 G A 1: 179,739,987 Q73* probably null Het
Med1 T C 11: 98,155,995 probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nf1 A G 11: 79,547,885 probably null Het
Oxct2b G A 4: 123,117,369 V361I probably benign Het
Pid1 T C 1: 84,038,141 M168V probably damaging Het
Plk1 A G 7: 122,168,629 D419G probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sem1 T C 6: 6,560,501 D26G possibly damaging Het
Sin3a C T 9: 57,125,203 R1141* probably null Het
Slf1 C T 13: 77,126,371 A68T probably damaging Het
Trmo A G 4: 46,380,278 S364P probably damaging Het
Uchl3 A G 14: 101,654,092 E10G probably damaging Het
Usp14 C T 18: 10,000,490 probably null Het
Vmn1r203 T A 13: 22,524,586 M179K probably benign Het
Vps13a A G 19: 16,619,446 Y3103H probably damaging Het
Zfp804a T C 2: 82,257,246 L473P probably benign Het
Zfp979 A T 4: 147,613,224 Y343N probably benign Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense possibly damaging 0.88
R7627:Mamdc4 UTSW 2 25568213 missense probably damaging 1.00
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTATGTCATCCAGGGCCATTGTG -3'
(R):5'- GTCCCCAAGGAATGTCTCAGCTTC -3'

Sequencing Primer
(F):5'- TCAAACAGCAACTGAGGGTG -3'
(R):5'- TTCGATTTCCCGAGGCAG -3'
Posted On2014-02-11