Incidental Mutation 'R1365:Itch'
ID155993
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
MMRRC Submission 039430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1365 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155213031 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 752 (N752D)
Ref Sequence ENSEMBL: ENSMUSP00000105307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
Predicted Effect probably benign
Transcript: ENSMUST00000029126
AA Change: N752D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: N752D

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109685
AA Change: N752D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: N752D

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123497
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 G A 13: 98,075,124 T117M probably damaging Het
Asb15 T C 6: 24,567,270 I530T possibly damaging Het
Brca1 T C 11: 101,501,996 N1673S probably benign Het
Cd48 A T 1: 171,699,561 Q185L probably damaging Het
Cog2 A T 8: 124,540,974 K343I probably damaging Het
Dars2 G A 1: 161,044,994 Q546* probably null Het
Dst A G 1: 34,188,194 K1623E probably benign Het
Epn1 G A 7: 5,093,370 R221Q probably benign Het
Gtf2b T C 3: 142,771,466 I33T probably damaging Het
Hsf4 G T 8: 105,271,094 R156L probably damaging Het
Kif28 G A 1: 179,739,987 Q73* probably null Het
Mamdc4 T C 2: 25,566,024 Y790C probably damaging Het
Med1 T C 11: 98,155,995 probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nf1 A G 11: 79,547,885 probably null Het
Oxct2b G A 4: 123,117,369 V361I probably benign Het
Pid1 T C 1: 84,038,141 M168V probably damaging Het
Plk1 A G 7: 122,168,629 D419G probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sem1 T C 6: 6,560,501 D26G possibly damaging Het
Sin3a C T 9: 57,125,203 R1141* probably null Het
Slf1 C T 13: 77,126,371 A68T probably damaging Het
Trmo A G 4: 46,380,278 S364P probably damaging Het
Uchl3 A G 14: 101,654,092 E10G probably damaging Het
Usp14 C T 18: 10,000,490 probably null Het
Vmn1r203 T A 13: 22,524,586 M179K probably benign Het
Vps13a A G 19: 16,619,446 Y3103H probably damaging Het
Zfp804a T C 2: 82,257,246 L473P probably benign Het
Zfp979 A T 4: 147,613,224 Y343N probably benign Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
dorsolateral UTSW 2 155210558 nonsense probably null
gadfly UTSW 2 155182298 nonsense probably null
hankerin UTSW 2 155210582 critical splice donor site probably null
prurient UTSW 2 155210502 missense probably damaging 1.00
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 splice site probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R2850:Itch UTSW 2 155202221 missense probably benign
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R7974:Itch UTSW 2 155192159 missense probably damaging 1.00
R8046:Itch UTSW 2 155210502 missense probably damaging 1.00
R8248:Itch UTSW 2 155206383 critical splice donor site probably null
R8355:Itch UTSW 2 155210582 critical splice donor site probably null
R8428:Itch UTSW 2 155168707 missense probably benign 0.38
R8691:Itch UTSW 2 155210558 nonsense probably null
R8779:Itch UTSW 2 155172520 missense probably benign 0.28
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAGTCAGGCTGACAGAACTTGATG -3'
(R):5'- CCGTAAACTCTGGCAAAGGTACAAGG -3'

Sequencing Primer
(F):5'- GTCGAGTTTCCTGATGCTTGC -3'
(R):5'- CAAAGGTACAAGGTATGTGTTGCTC -3'
Posted On2014-02-11