Incidental Mutation 'R1365:Sem1'
ID155998
Institutional Source Beutler Lab
Gene Symbol Sem1
Ensembl Gene ENSMUSG00000042541
Gene NameSEM1, 26S proteasome complex subunit
SynonymsShfdg1, Shfg, Shfm1, DSS1
MMRRC Submission 039430-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R1365 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location6557294-6578663 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6560501 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 26 (D26G)
Ref Sequence ENSEMBL: ENSMUSP00000040741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041111
AA Change: D26G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000040741
Gene: ENSMUSG00000042541
AA Change: D26G

DomainStartEndE-ValueType
DSS1_SEM1 5 62 1.43e-26 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 G A 13: 98,075,124 T117M probably damaging Het
Asb15 T C 6: 24,567,270 I530T possibly damaging Het
Brca1 T C 11: 101,501,996 N1673S probably benign Het
Cd48 A T 1: 171,699,561 Q185L probably damaging Het
Cog2 A T 8: 124,540,974 K343I probably damaging Het
Dars2 G A 1: 161,044,994 Q546* probably null Het
Dst A G 1: 34,188,194 K1623E probably benign Het
Epn1 G A 7: 5,093,370 R221Q probably benign Het
Gtf2b T C 3: 142,771,466 I33T probably damaging Het
Hsf4 G T 8: 105,271,094 R156L probably damaging Het
Itch A G 2: 155,213,031 N752D probably benign Het
Kif28 G A 1: 179,739,987 Q73* probably null Het
Mamdc4 T C 2: 25,566,024 Y790C probably damaging Het
Med1 T C 11: 98,155,995 probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nf1 A G 11: 79,547,885 probably null Het
Oxct2b G A 4: 123,117,369 V361I probably benign Het
Pid1 T C 1: 84,038,141 M168V probably damaging Het
Plk1 A G 7: 122,168,629 D419G probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sin3a C T 9: 57,125,203 R1141* probably null Het
Slf1 C T 13: 77,126,371 A68T probably damaging Het
Trmo A G 4: 46,380,278 S364P probably damaging Het
Uchl3 A G 14: 101,654,092 E10G probably damaging Het
Usp14 C T 18: 10,000,490 probably null Het
Vmn1r203 T A 13: 22,524,586 M179K probably benign Het
Vps13a A G 19: 16,619,446 Y3103H probably damaging Het
Zfp804a T C 2: 82,257,246 L473P probably benign Het
Zfp979 A T 4: 147,613,224 Y343N probably benign Het
Other mutations in Sem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3615:Sem1 UTSW 6 6578520 missense probably damaging 0.98
R3616:Sem1 UTSW 6 6578520 missense probably damaging 0.98
R6710:Sem1 UTSW 6 6578497 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ccagaacaggcaaaGCAGGTGAA -3'
(R):5'- tgtatggaGGGGATGAGAACAAGAGAAC -3'

Sequencing Primer
(F):5'- ggcaaaGCAGGTGAACTTGTG -3'
(R):5'- TGAGAACAAGAGAACAAATGTTGC -3'
Posted On2014-02-11