Incidental Mutation 'R1365:Hsf4'
ID156002
Institutional Source Beutler Lab
Gene Symbol Hsf4
Ensembl Gene ENSMUSG00000033249
Gene Nameheat shock transcription factor 4
Synonymsldis1
MMRRC Submission 039430-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1365 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105269801-105275845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105271094 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 156 (R156L)
Ref Sequence ENSEMBL: ENSMUSP00000134477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036127
AA Change: R156L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249
AA Change: R156L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000036221
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163734
AA Change: R96L

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249
AA Change: R96L

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172525
AA Change: R156L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249
AA Change: R156L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect possibly damaging
Transcript: ENSMUST00000173640
AA Change: R156L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249
AA Change: R156L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000173859
AA Change: R156L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249
AA Change: R156L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000174837
AA Change: R156L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249
AA Change: R156L

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal lens morphology and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 G A 13: 98,075,124 T117M probably damaging Het
Asb15 T C 6: 24,567,270 I530T possibly damaging Het
Brca1 T C 11: 101,501,996 N1673S probably benign Het
Cd48 A T 1: 171,699,561 Q185L probably damaging Het
Cog2 A T 8: 124,540,974 K343I probably damaging Het
Dars2 G A 1: 161,044,994 Q546* probably null Het
Dst A G 1: 34,188,194 K1623E probably benign Het
Epn1 G A 7: 5,093,370 R221Q probably benign Het
Gtf2b T C 3: 142,771,466 I33T probably damaging Het
Itch A G 2: 155,213,031 N752D probably benign Het
Kif28 G A 1: 179,739,987 Q73* probably null Het
Mamdc4 T C 2: 25,566,024 Y790C probably damaging Het
Med1 T C 11: 98,155,995 probably benign Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nf1 A G 11: 79,547,885 probably null Het
Oxct2b G A 4: 123,117,369 V361I probably benign Het
Pid1 T C 1: 84,038,141 M168V probably damaging Het
Plk1 A G 7: 122,168,629 D419G probably damaging Het
Rasl10b G A 11: 83,417,839 probably null Het
Rps24 A G 14: 24,491,762 T6A probably damaging Het
Sem1 T C 6: 6,560,501 D26G possibly damaging Het
Sin3a C T 9: 57,125,203 R1141* probably null Het
Slf1 C T 13: 77,126,371 A68T probably damaging Het
Trmo A G 4: 46,380,278 S364P probably damaging Het
Uchl3 A G 14: 101,654,092 E10G probably damaging Het
Usp14 C T 18: 10,000,490 probably null Het
Vmn1r203 T A 13: 22,524,586 M179K probably benign Het
Vps13a A G 19: 16,619,446 Y3103H probably damaging Het
Zfp804a T C 2: 82,257,246 L473P probably benign Het
Zfp979 A T 4: 147,613,224 Y343N probably benign Het
Other mutations in Hsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Hsf4 APN 8 105275657 makesense probably null
IGL01702:Hsf4 APN 8 105271589 missense probably damaging 1.00
IGL02040:Hsf4 APN 8 105275667 unclassified probably benign
R0115:Hsf4 UTSW 8 105272704 critical splice acceptor site probably null
R0449:Hsf4 UTSW 8 105275590 missense probably benign 0.04
R0585:Hsf4 UTSW 8 105271031 missense probably damaging 1.00
R1401:Hsf4 UTSW 8 105275603 missense probably benign
R2276:Hsf4 UTSW 8 105269996 missense probably null 0.91
R2278:Hsf4 UTSW 8 105269996 missense probably null 0.91
R3848:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R3850:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R4240:Hsf4 UTSW 8 105274881 missense possibly damaging 0.58
R4781:Hsf4 UTSW 8 105274752 critical splice donor site probably null
R4790:Hsf4 UTSW 8 105270605 missense probably damaging 1.00
R4917:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4918:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4930:Hsf4 UTSW 8 105272698 splice site probably null
R5110:Hsf4 UTSW 8 105272795 missense probably benign 0.01
R5189:Hsf4 UTSW 8 105271428 frame shift probably null
R6001:Hsf4 UTSW 8 105272909 missense possibly damaging 0.70
R6167:Hsf4 UTSW 8 105270849 missense probably damaging 1.00
R6802:Hsf4 UTSW 8 105274668 missense probably damaging 1.00
R7231:Hsf4 UTSW 8 105272147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACCACGTTGAGTTTCAGCATCC -3'
(R):5'- TGAGTTCGCCCAGGTACAATTCCC -3'

Sequencing Primer
(F):5'- GAGTTTCAGCATCCGAGCTTC -3'
(R):5'- AGAGGTCCAGACTCTGTTGC -3'
Posted On2014-02-11