Mutagenetix > Incidental Mutation

Incidental Mutation 'R1365:Cog2'

156004

Institutional Source

Beutler Lab

Gene Symbol

Cog2

Ensembl Gene

ENSMUSG00000031979

Gene Name

component of oligomeric golgi complex 2

Synonyms

2700012E02Rik, 1190002B08Rik, Cog2

MMRRC Submission

039430-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1365 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

124520767-124552008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 124540974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Isoleucine at position 343 (K343I)

Ref Sequence

ENSEMBL: ENSMUSP00000034460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034460]

AlphaFold

Q921L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000034460
AA Change: K343I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000034460
Gene: ENSMUSG00000031979
AA Change: K343I

Domain	Start	End	E-Value	Type
Pfam:COG2	15	147	1.4e-44	PFAM
low complexity region	207	220	N/A	INTRINSIC
low complexity region	490	502	N/A	INTRINSIC
Pfam:DUF3510	565	692	6.1e-45	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000108803

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129977

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the conserved oligomeric Golgi complex that is required for maintaining normal structure and activity of the Golgi complex. The encoded protein specifically interacts with the USO1 vesicle docking protein and may be necessary for normal Golgi ribbon formation and trafficking of Golgi enzymes. Mutations of this gene are associated with abnormal glycosylation within the Golgi apparatus. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef28	G	A	13: 98,075,124	T117M	probably damaging	Het
Asb15	T	C	6: 24,567,270	I530T	possibly damaging	Het
Brca1	T	C	11: 101,501,996	N1673S	probably benign	Het
Cd48	A	T	1: 171,699,561	Q185L	probably damaging	Het
Dars2	G	A	1: 161,044,994	Q546*	probably null	Het
Dst	A	G	1: 34,188,194	K1623E	probably benign	Het
Epn1	G	A	7: 5,093,370	R221Q	probably benign	Het
Gtf2b	T	C	3: 142,771,466	I33T	probably damaging	Het
Hsf4	G	T	8: 105,271,094	R156L	probably damaging	Het
Itch	A	G	2: 155,213,031	N752D	probably benign	Het
Kif28	G	A	1: 179,739,987	Q73*	probably null	Het
Mamdc4	T	C	2: 25,566,024	Y790C	probably damaging	Het
Med1	T	C	11: 98,155,995		probably benign	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Nf1	A	G	11: 79,547,885		probably null	Het
Oxct2b	G	A	4: 123,117,369	V361I	probably benign	Het
Pid1	T	C	1: 84,038,141	M168V	probably damaging	Het
Plk1	A	G	7: 122,168,629	D419G	probably damaging	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Rps24	A	G	14: 24,491,762	T6A	probably damaging	Het
Sem1	T	C	6: 6,560,501	D26G	possibly damaging	Het
Sin3a	C	T	9: 57,125,203	R1141*	probably null	Het
Slf1	C	T	13: 77,126,371	A68T	probably damaging	Het
Trmo	A	G	4: 46,380,278	S364P	probably damaging	Het
Uchl3	A	G	14: 101,654,092	E10G	probably damaging	Het
Usp14	C	T	18: 10,000,490		probably null	Het
Vmn1r203	T	A	13: 22,524,586	M179K	probably benign	Het
Vps13a	A	G	19: 16,619,446	Y3103H	probably damaging	Het
Zfp804a	T	C	2: 82,257,246	L473P	probably benign	Het
Zfp979	A	T	4: 147,613,224	Y343N	probably benign	Het

Other mutations in Cog2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01089:Cog2	APN	8	124545243	missense	probably benign	0.00
IGL01092:Cog2	APN	8	124545280	missense	probably damaging	1.00
IGL01150:Cog2	APN	8	124542891	missense	possibly damaging	0.62
IGL02052:Cog2	APN	8	124542888	critical splice acceptor site	probably null
IGL02308:Cog2	APN	8	124533212	critical splice acceptor site	probably null
IGL02543:Cog2	APN	8	124529959	missense	probably benign	0.09
IGL02978:Cog2	APN	8	124550336	missense	probably benign
IGL03008:Cog2	APN	8	124535392	splice site	probably benign
IGL03144:Cog2	APN	8	124541024	missense	probably damaging	0.98
kugge	UTSW	8	124550232	missense	probably damaging	1.00
Pelota	UTSW	8	124550306	missense	probably damaging	1.00
PIT4677001:Cog2	UTSW	8	124545271	missense	probably benign	0.22
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0071:Cog2	UTSW	8	124548668	splice site	probably benign
R0110:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R0436:Cog2	UTSW	8	124548514	splice site	probably benign
R0450:Cog2	UTSW	8	124529058	critical splice donor site	probably null
R1661:Cog2	UTSW	8	124542890	missense	probably benign	0.20
R1698:Cog2	UTSW	8	124525683	missense	probably damaging	1.00
R1856:Cog2	UTSW	8	124551403	missense	possibly damaging	0.93
R2122:Cog2	UTSW	8	124528985	missense	possibly damaging	0.91
R2398:Cog2	UTSW	8	124529926	missense	probably benign	0.07
R3855:Cog2	UTSW	8	124530003	critical splice donor site	probably null
R4580:Cog2	UTSW	8	124545136	missense	probably benign	0.01
R4803:Cog2	UTSW	8	124535451	missense	probably damaging	0.96
R5316:Cog2	UTSW	8	124529040	missense	probably benign	0.14
R5346:Cog2	UTSW	8	124546631	missense	possibly damaging	0.94
R5394:Cog2	UTSW	8	124532529	missense	probably benign	0.00
R5395:Cog2	UTSW	8	124545221	missense	probably benign	0.00
R5738:Cog2	UTSW	8	124546038	missense	probably benign	0.03
R5861:Cog2	UTSW	8	124537878	missense	probably damaging	1.00
R5894:Cog2	UTSW	8	124545267	missense	probably benign	0.00
R5941:Cog2	UTSW	8	124546086	missense	probably benign
R6186:Cog2	UTSW	8	124546686	missense	probably damaging	1.00
R6400:Cog2	UTSW	8	124550306	missense	probably damaging	1.00
R6518:Cog2	UTSW	8	124527103	nonsense	probably null
R6558:Cog2	UTSW	8	124550232	missense	probably damaging	1.00
R6717:Cog2	UTSW	8	124525749	missense	probably damaging	1.00
R6902:Cog2	UTSW	8	124546691	missense	probably damaging	1.00
R6914:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R6942:Cog2	UTSW	8	124545136	missense	probably benign	0.00
R7103:Cog2	UTSW	8	124541114	critical splice donor site	probably null
R7274:Cog2	UTSW	8	124535519	missense	possibly damaging	0.71
R7641:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R7674:Cog2	UTSW	8	124537882	missense	probably damaging	0.96
R8559:Cog2	UTSW	8	124542908	missense	probably benign	0.25
R9190:Cog2	UTSW	8	124533319	missense	probably damaging	1.00
R9307:Cog2	UTSW	8	124527098	critical splice acceptor site	probably null
R9629:Cog2	UTSW	8	124533386	missense	possibly damaging	0.67
X0026:Cog2	UTSW	8	124546020	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GAAGTTGGAGTTATCAGGAGGCTGC -3'
(R):5'- TGTACACTCACACGAATGTTGTCGC -3'

Sequencing Primer
(F):5'- TATCAGGAGGCTGCCCTGAG -3'
(R):5'- CCAGGGACTGAACACCTATTTTC -3'

Posted On

2014-02-11