Mutagenetix > Incidental Mutation

Incidental Mutation 'R1365:Rps24'

156014

Institutional Source

Beutler Lab

Gene Symbol

Rps24

Ensembl Gene

ENSMUSG00000025290

Gene Name

ribosomal protein S24

Synonyms

MRP S24

MMRRC Submission

039430-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.826) question?

Stock #

R1365 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24540746-24547028 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24541830 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 6 (T6A)

Ref Sequence

ENSEMBL: ENSMUSP00000152944 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000225023] [ENSMUST00000224568]

AlphaFold

P62849

Predicted Effect

probably benign
Transcript: ENSMUST00000026322

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112384
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: T6A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	23	108	4.4e-41	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000169826
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: T6A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	24	102	1.9e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223939

Predicted Effect

probably damaging
Transcript: ENSMUST00000223999
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000225023
AA Change: T6A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225994

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224699

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225117

Predicted Effect

probably benign
Transcript: ENSMUST00000224568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224549

Meta Mutation Damage Score

0.2687

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef28	G	A	13: 98,211,632 (GRCm39)	T117M	probably damaging	Het
Asb15	T	C	6: 24,567,269 (GRCm39)	I530T	possibly damaging	Het
Brca1	T	C	11: 101,392,822 (GRCm39)	N1673S	probably benign	Het
Cd48	A	T	1: 171,527,129 (GRCm39)	Q185L	probably damaging	Het
Cog2	A	T	8: 125,267,713 (GRCm39)	K343I	probably damaging	Het
Dars2	G	A	1: 160,872,564 (GRCm39)	Q546*	probably null	Het
Dst	A	G	1: 34,227,275 (GRCm39)	K1623E	probably benign	Het
Epn1	G	A	7: 5,096,369 (GRCm39)	R221Q	probably benign	Het
Gtf2b	T	C	3: 142,477,227 (GRCm39)	I33T	probably damaging	Het
Hsf4	G	T	8: 105,997,726 (GRCm39)	R156L	probably damaging	Het
Itch	A	G	2: 155,054,951 (GRCm39)	N752D	probably benign	Het
Kif28	G	A	1: 179,567,552 (GRCm39)	Q73*	probably null	Het
Mamdc4	T	C	2: 25,456,036 (GRCm39)	Y790C	probably damaging	Het
Med1	T	C	11: 98,046,821 (GRCm39)		probably benign	Het
Mfsd13a	C	T	19: 46,354,943 (GRCm39)	T40I	probably benign	Het
Nf1	A	G	11: 79,438,711 (GRCm39)		probably null	Het
Oxct2b	G	A	4: 123,011,162 (GRCm39)	V361I	probably benign	Het
Pid1	T	C	1: 84,015,862 (GRCm39)	M168V	probably damaging	Het
Plk1	A	G	7: 121,767,852 (GRCm39)	D419G	probably damaging	Het
Rasl10b	G	A	11: 83,308,665 (GRCm39)		probably null	Het
Sem1	T	C	6: 6,560,501 (GRCm39)	D26G	possibly damaging	Het
Sin3a	C	T	9: 57,032,487 (GRCm39)	R1141*	probably null	Het
Slf1	C	T	13: 77,274,490 (GRCm39)	A68T	probably damaging	Het
Trmo	A	G	4: 46,380,278 (GRCm39)	S364P	probably damaging	Het
Uchl3	A	G	14: 101,891,528 (GRCm39)	E10G	probably damaging	Het
Usp14	C	T	18: 10,000,490 (GRCm39)		probably null	Het
Vmn1r203	T	A	13: 22,708,756 (GRCm39)	M179K	probably benign	Het
Vps13a	A	G	19: 16,596,810 (GRCm39)	Y3103H	probably damaging	Het
Zfp804a	T	C	2: 82,087,590 (GRCm39)	L473P	probably benign	Het
Zfp979	A	T	4: 147,697,681 (GRCm39)	Y343N	probably benign	Het

Other mutations in Rps24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02049:Rps24	APN	14	24,541,823 (GRCm39)	missense	probably benign
R1209:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1317:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1363:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1393:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1427:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1429:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1771:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1776:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R2916:Rps24	UTSW	14	24,542,009 (GRCm39)	missense	probably benign	0.02
R4837:Rps24	UTSW	14	24,541,855 (GRCm39)	missense	possibly damaging	0.93
R6146:Rps24	UTSW	14	24,540,803 (GRCm39)	start gained	probably null
R6249:Rps24	UTSW	14	24,543,530 (GRCm39)	missense	possibly damaging	0.92
R6386:Rps24	UTSW	14	24,542,116 (GRCm39)	missense	possibly damaging	0.79
R7316:Rps24	UTSW	14	24,540,757 (GRCm39)	unclassified	probably benign
R8402:Rps24	UTSW	14	24,540,829 (GRCm39)	splice site	probably benign
V7732:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCTCGCTGAATGCCAGCTAC -3'
(R):5'- CCCAGGATGAAGGACATCAATGACC -3'

Sequencing Primer
(F):5'- TCTCCAAGCACTAGAGGCATTG -3'
(R):5'- TGACCTATAAAGAGGTGTAAGAGTC -3'

Posted On

2014-02-11