Mutagenetix > Incidental Mutation

Incidental Mutation 'R1366:Ilkap'

156020

Institutional Source

Beutler Lab

Gene Symbol

Ilkap

Ensembl Gene

ENSMUSG00000026309

Gene Name

integrin-linked kinase-associated serine/threonine phosphatase 2C

Synonyms

1600009O09Rik, 0710007A14Rik, PP2C-DELTA

MMRRC Submission

039431-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.221) question?

Stock #

R1366 (G1)

Quality Score

147

Status

Validated

Chromosome

Chromosomal Location

91373861-91398815 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91387215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 142 (I142T)

Ref Sequence

ENSEMBL: ENSMUSP00000027534 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027534] [ENSMUST00000186986] [ENSMUST00000187306] [ENSMUST00000187678] [ENSMUST00000190519] [ENSMUST00000190747]

AlphaFold

Q8R0F6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027534
AA Change: I142T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000027534
Gene: ENSMUSG00000026309
AA Change: I142T

Domain	Start	End	E-Value	Type
Blast:PP2C_SIG	26	64	4e-12	BLAST
PP2Cc	94	388	4.47e-93	SMART
PP2C_SIG	128	390	9.82e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186433

Predicted Effect

probably benign
Transcript: ENSMUST00000186986

SMART Domains

Protein: ENSMUSP00000140074
Gene: ENSMUSG00000026309

Domain	Start	End	E-Value	Type
Blast:PP2Cc	7	72	9e-24	BLAST
low complexity region	83	96	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187049

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187105

Predicted Effect

probably benign
Transcript: ENSMUST00000187231

Predicted Effect

probably benign
Transcript: ENSMUST00000187306

SMART Domains

Protein: ENSMUSP00000139834
Gene: ENSMUSG00000026309

Domain	Start	End	E-Value	Type
Blast:PP2Cc	7	73	2e-24	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000187678

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189651

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190519
AA Change: I136T

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000140048
Gene: ENSMUSG00000026309
AA Change: I136T

Domain	Start	End	E-Value	Type
Blast:PP2C_SIG	26	136	2e-36	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000190747

SMART Domains

Protein: ENSMUSP00000140905
Gene: ENSMUSG00000026309

Domain	Start	End	E-Value	Type
PP2Cc	1	164	7.3e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191230

Meta Mutation Damage Score

0.0918

Coding Region Coverage

1x: 98.6%
3x: 97.1%
10x: 92.3%
20x: 80.8%

Validation Efficiency

93% (43/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a protein serine/threonine phosphatase of the PP2C family. This protein can interact with integrin-linked kinase (ILK/ILK1), a regulator of integrin mediated signaling, and regulate the kinase activity of ILK. Through the interaction with ILK, this protein may selectively affect the signaling process of ILK-mediated glycogen synthase kinase 3 beta (GSK3beta), and thus participate in Wnt signaling pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null gene trap insertion exhibit enhanced motor coordination, and male homozygous mice exhibit increased cholesterol levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	A	5: 31,487,517	C205S	probably benign	Het
Aasdh	A	T	5: 76,888,804	S297T	probably benign	Het
Acsm1	T	C	7: 119,658,288		probably benign	Het
Ankar	T	A	1: 72,698,649	N125Y	probably damaging	Het
Chd1l	T	C	3: 97,581,149	D517G	probably damaging	Het
Cir1	A	T	2: 73,306,413		probably benign	Het
Cpxm1	G	A	2: 130,396,122	R136W	probably damaging	Het
Cyhr1	T	C	15: 76,648,969	R190G	probably damaging	Het
Dnah10	A	T	5: 124,753,326	E761D	probably benign	Het
Fam186a	T	A	15: 99,943,389	E1658V	possibly damaging	Het
Fam98a	A	G	17: 75,539,386		probably benign	Het
Fanca	G	A	8: 123,304,281		probably benign	Het
Frmd6	T	C	12: 70,887,889		probably benign	Het
Gmpr2	T	C	14: 55,676,743		probably benign	Het
Hck	G	A	2: 153,138,295	G348D	probably damaging	Het
Ifnab	T	A	4: 88,691,100	Q43L	possibly damaging	Het
Lamc3	T	C	2: 31,928,847	S1206P	probably damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mkrn1	T	C	6: 39,405,917	T134A	probably benign	Het
Mmp9	T	A	2: 164,953,342	V628E	probably damaging	Het
Msi2	A	T	11: 88,716,580	V67D	probably damaging	Het
Ncapd3	T	A	9: 27,057,940	V630E	probably damaging	Het
Nkain1	A	G	4: 130,537,316	V73A	probably damaging	Het
Nphp4	T	A	4: 152,502,926	D245E	probably damaging	Het
Olfr1014	G	A	2: 85,777,004	C140Y	probably benign	Het
Olfr114	T	C	17: 37,589,764	I196M	probably benign	Het
Olfr57	T	G	10: 79,035,042	M82R	probably damaging	Het
Pkd1l1	T	C	11: 8,941,038		probably benign	Het
Plcxd1	A	C	5: 110,102,230	I184L	probably damaging	Het
Prl3b1	G	A	13: 27,243,865	A53T	probably benign	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Scube2	A	G	7: 109,804,614	Y890H	probably damaging	Het
Slco6c1	T	A	1: 97,128,203		probably null	Het
Tnfaip2	T	G	12: 111,449,322	F485V	probably benign	Het
Tpd52	T	C	3: 8,963,933	D17G	probably damaging	Het
Ube4b	T	C	4: 149,335,149	D1034G	probably damaging	Het
Vmn2r118	G	A	17: 55,593,237	Q556*	probably null	Het

Other mutations in Ilkap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Ilkap	APN	1	91385238	critical splice donor site	probably null
PIT4445001:Ilkap	UTSW	1	91385345	missense	probably benign
R0184:Ilkap	UTSW	1	91376305	unclassified	probably benign
R0782:Ilkap	UTSW	1	91378550	missense	probably damaging	1.00
R1552:Ilkap	UTSW	1	91384594	missense	probably damaging	1.00
R2155:Ilkap	UTSW	1	91384623	missense	possibly damaging	0.65
R3946:Ilkap	UTSW	1	91387250	missense	probably damaging	1.00
R4005:Ilkap	UTSW	1	91385263	missense	probably benign	0.03
R4860:Ilkap	UTSW	1	91387383	unclassified	probably benign
R5666:Ilkap	UTSW	1	91391141	missense	probably benign	0.38
R5670:Ilkap	UTSW	1	91391141	missense	probably benign	0.38
R7324:Ilkap	UTSW	1	91385393	splice site	probably null
R8493:Ilkap	UTSW	1	91378544	missense	probably damaging	1.00
R8548:Ilkap	UTSW	1	91391160	missense	possibly damaging	0.81
R9227:Ilkap	UTSW	1	91387215	missense	probably benign	0.41
R9230:Ilkap	UTSW	1	91387215	missense	probably benign	0.41
R9620:Ilkap	UTSW	1	91376251	missense
R9694:Ilkap	UTSW	1	91376251	missense

Predicted Primers

PCR Primer
(F):5'- GGGGCAGTCCCTTGTTTAGCAATG -3'
(R):5'- CTTTGTGGCAGAACCCTGAATTGTG -3'

Sequencing Primer
(F):5'- CTACTCCAAAAATATCCTCAGATGG -3'
(R):5'- TAGGCTGCCGTAGTACCTC -3'

Posted On

2014-02-11