Mutagenetix > Incidental Mutation

Incidental Mutation 'R1366:Lamc3'

156022

Institutional Source

Beutler Lab

Gene Symbol

Lamc3

Ensembl Gene

ENSMUSG00000026840

Gene Name

laminin gamma 3

Synonyms

MMRRC Submission

039431-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1366 (G1)

Quality Score

174

Status

Validated

Chromosome

Chromosomal Location

31887291-31946539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31928847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1206 (S1206P)

Ref Sequence

ENSEMBL: ENSMUSP00000118745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]

AlphaFold

Q9R0B6

Predicted Effect

probably damaging
Transcript: ENSMUST00000028187
AA Change: S1195P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: S1195P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1234	1247	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
coiled coil region	1444	1467	N/A	INTRINSIC
coiled coil region	1528	1575	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135995

Predicted Effect

probably damaging
Transcript: ENSMUST00000138325
AA Change: S1206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: S1206P

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1245	1258	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
coiled coil region	1455	1478	N/A	INTRINSIC

Meta Mutation Damage Score

0.2036

Coding Region Coverage

1x: 98.6%
3x: 97.1%
10x: 92.3%
20x: 80.8%

Validation Efficiency

93% (43/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930548H24Rik	T	A	5: 31,487,517	C205S	probably benign	Het
Aasdh	A	T	5: 76,888,804	S297T	probably benign	Het
Acsm1	T	C	7: 119,658,288		probably benign	Het
Ankar	T	A	1: 72,698,649	N125Y	probably damaging	Het
Chd1l	T	C	3: 97,581,149	D517G	probably damaging	Het
Cir1	A	T	2: 73,306,413		probably benign	Het
Cpxm1	G	A	2: 130,396,122	R136W	probably damaging	Het
Cyhr1	T	C	15: 76,648,969	R190G	probably damaging	Het
Dnah10	A	T	5: 124,753,326	E761D	probably benign	Het
Fam186a	T	A	15: 99,943,389	E1658V	possibly damaging	Het
Fam98a	A	G	17: 75,539,386		probably benign	Het
Fanca	G	A	8: 123,304,281		probably benign	Het
Frmd6	T	C	12: 70,887,889		probably benign	Het
Gmpr2	T	C	14: 55,676,743		probably benign	Het
Hck	G	A	2: 153,138,295	G348D	probably damaging	Het
Ifnab	T	A	4: 88,691,100	Q43L	possibly damaging	Het
Ilkap	A	G	1: 91,387,215	I142T	possibly damaging	Het
Mfsd13a	C	T	19: 46,366,504	T40I	probably benign	Het
Mid1	A	C	X: 169,986,094	N215H	probably damaging	Het
Mkrn1	T	C	6: 39,405,917	T134A	probably benign	Het
Mmp9	T	A	2: 164,953,342	V628E	probably damaging	Het
Msi2	A	T	11: 88,716,580	V67D	probably damaging	Het
Ncapd3	T	A	9: 27,057,940	V630E	probably damaging	Het
Nkain1	A	G	4: 130,537,316	V73A	probably damaging	Het
Nphp4	T	A	4: 152,502,926	D245E	probably damaging	Het
Olfr1014	G	A	2: 85,777,004	C140Y	probably benign	Het
Olfr114	T	C	17: 37,589,764	I196M	probably benign	Het
Olfr57	T	G	10: 79,035,042	M82R	probably damaging	Het
Pkd1l1	T	C	11: 8,941,038		probably benign	Het
Plcxd1	A	C	5: 110,102,230	I184L	probably damaging	Het
Prl3b1	G	A	13: 27,243,865	A53T	probably benign	Het
Rasl10b	G	A	11: 83,417,839		probably null	Het
Scube2	A	G	7: 109,804,614	Y890H	probably damaging	Het
Slco6c1	T	A	1: 97,128,203		probably null	Het
Tnfaip2	T	G	12: 111,449,322	F485V	probably benign	Het
Tpd52	T	C	3: 8,963,933	D17G	probably damaging	Het
Ube4b	T	C	4: 149,335,149	D1034G	probably damaging	Het
Vmn2r118	G	A	17: 55,593,237	Q556*	probably null	Het

Other mutations in Lamc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Lamc3	APN	2	31900581	missense	probably damaging	0.99
IGL00823:Lamc3	APN	2	31918521	missense	probably damaging	1.00
IGL01020:Lamc3	APN	2	31914656	missense	probably benign	0.07
IGL01086:Lamc3	APN	2	31898476	missense	probably damaging	1.00
IGL01618:Lamc3	APN	2	31912107	missense	probably damaging	0.99
IGL01655:Lamc3	APN	2	31898278	missense	probably damaging	1.00
IGL02093:Lamc3	APN	2	31887655	missense	probably damaging	1.00
IGL02309:Lamc3	APN	2	31914604	splice site	probably benign
IGL02340:Lamc3	APN	2	31918457	missense	probably damaging	1.00
IGL02410:Lamc3	APN	2	31905965	missense	probably damaging	0.99
IGL02548:Lamc3	APN	2	31920662	missense	probably benign	0.00
IGL02679:Lamc3	APN	2	31945398	missense	probably benign	0.01
IGL02751:Lamc3	APN	2	31920704	missense	probably benign	0.07
IGL02820:Lamc3	APN	2	31923022	missense	probably damaging	1.00
IGL02926:Lamc3	APN	2	31935725	splice site	probably benign
IGL02926:Lamc3	APN	2	31935726	splice site	probably benign
IGL03090:Lamc3	APN	2	31908698	splice site	probably benign
IGL03258:Lamc3	APN	2	31887683	missense	probably damaging	1.00
R0005:Lamc3	UTSW	2	31922428	missense	probably benign	0.07
R0137:Lamc3	UTSW	2	31908616	missense	probably damaging	1.00
R0179:Lamc3	UTSW	2	31915084	splice site	probably benign
R0244:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R0512:Lamc3	UTSW	2	31937968	missense	probably damaging	1.00
R1052:Lamc3	UTSW	2	31928802	missense	probably benign	0.03
R1142:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R1463:Lamc3	UTSW	2	31887411	missense	probably benign
R1515:Lamc3	UTSW	2	31940751	missense	probably damaging	1.00
R1642:Lamc3	UTSW	2	31915996	missense	probably damaging	1.00
R1692:Lamc3	UTSW	2	31921781	missense	probably null	0.01
R1707:Lamc3	UTSW	2	31912129	critical splice donor site	probably null
R1714:Lamc3	UTSW	2	31940757	missense	probably benign	0.02
R1838:Lamc3	UTSW	2	31925582	missense	possibly damaging	0.89
R2940:Lamc3	UTSW	2	31940702	missense	probably benign	0.02
R3177:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3277:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3846:Lamc3	UTSW	2	31924592	missense	probably benign	0.01
R4065:Lamc3	UTSW	2	31945258	missense	probably benign	0.00
R4089:Lamc3	UTSW	2	31920508	nonsense	probably null
R4373:Lamc3	UTSW	2	31898232	missense	probably damaging	1.00
R4394:Lamc3	UTSW	2	31931952	missense	probably benign
R4395:Lamc3	UTSW	2	31931952	missense	probably benign
R4397:Lamc3	UTSW	2	31931952	missense	probably benign
R4746:Lamc3	UTSW	2	31905614	missense	possibly damaging	0.77
R4948:Lamc3	UTSW	2	31940736	missense	probably benign	0.02
R4960:Lamc3	UTSW	2	31915954	missense	probably benign	0.00
R5025:Lamc3	UTSW	2	31908669	missense	probably benign	0.13
R5062:Lamc3	UTSW	2	31905667	missense	possibly damaging	0.60
R5170:Lamc3	UTSW	2	31887344	start codon destroyed	probably benign	0.03
R5286:Lamc3	UTSW	2	31918596	missense	probably damaging	1.00
R5457:Lamc3	UTSW	2	31931985	missense	probably benign
R5655:Lamc3	UTSW	2	31925717	missense	probably benign	0.01
R5928:Lamc3	UTSW	2	31921709	missense	probably benign	0.00
R6018:Lamc3	UTSW	2	31905712	missense	probably damaging	1.00
R6479:Lamc3	UTSW	2	31887401	missense	probably benign
R6601:Lamc3	UTSW	2	31920532	missense	possibly damaging	0.94
R6920:Lamc3	UTSW	2	31908689	missense	probably damaging	1.00
R6924:Lamc3	UTSW	2	31938069	missense	probably benign
R7114:Lamc3	UTSW	2	31930645	missense	probably damaging	0.99
R7305:Lamc3	UTSW	2	31930702	missense	probably benign	0.39
R7559:Lamc3	UTSW	2	31922368	missense	probably benign	0.00
R7714:Lamc3	UTSW	2	31922267	splice site	probably null
R7787:Lamc3	UTSW	2	31900539	missense	probably damaging	0.99
R7819:Lamc3	UTSW	2	31921763	missense	probably benign
R8171:Lamc3	UTSW	2	31914971	missense	probably benign	0.06
R8208:Lamc3	UTSW	2	31887414	missense	possibly damaging	0.47
R8412:Lamc3	UTSW	2	31912116	missense	probably damaging	0.98
R9058:Lamc3	UTSW	2	31908641	missense	probably benign	0.01
R9242:Lamc3	UTSW	2	31898311	missense	probably benign	0.14
R9269:Lamc3	UTSW	2	31923005	missense	probably benign	0.11
R9269:Lamc3	UTSW	2	31928896	nonsense	probably null
X0010:Lamc3	UTSW	2	31938012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGTCAAAACCCAGAGTGTCCC -3'
(R):5'- TGCCATTGACAGCGGAGACTTG -3'

Sequencing Primer
(F):5'- CCAGAGTGTCCCTGCTGTTG -3'
(R):5'- TTGACAGCGGAGACTTGAATGATAG -3'

Posted On

2014-02-11