Incidental Mutation 'R1366:Cir1'
ID 156023
Institutional Source Beutler Lab
Gene Symbol Cir1
Ensembl Gene ENSMUSG00000041777
Gene Name corepressor interacting with RBPJ, 1
Synonyms CIR, 2810021A19Rik, 1700023B02Rik
MMRRC Submission 039431-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1366 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 73113445-73142922 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 73136757 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000049834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058615]
AlphaFold Q9DA19
Predicted Effect probably benign
Transcript: ENSMUST00000058615
SMART Domains Protein: ENSMUSP00000049834
Gene: ENSMUSG00000041777

DomainStartEndE-ValueType
Cir_N 13 49 6.03e-14 SMART
low complexity region 79 97 N/A INTRINSIC
Blast:ZnF_C2HC 127 145 9e-6 BLAST
coiled coil region 213 261 N/A INTRINSIC
low complexity region 385 412 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136519
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,036,651 (GRCm39) S297T probably benign Het
Acsm1 T C 7: 119,257,511 (GRCm39) probably benign Het
Ankar T A 1: 72,737,808 (GRCm39) N125Y probably damaging Het
Ccdc121 T A 5: 31,644,861 (GRCm39) C205S probably benign Het
Chd1l T C 3: 97,488,465 (GRCm39) D517G probably damaging Het
Cpxm1 G A 2: 130,238,042 (GRCm39) R136W probably damaging Het
Dnah10 A T 5: 124,830,390 (GRCm39) E761D probably benign Het
Fam186a T A 15: 99,841,270 (GRCm39) E1658V possibly damaging Het
Fam98a A G 17: 75,846,381 (GRCm39) probably benign Het
Fanca G A 8: 124,031,020 (GRCm39) probably benign Het
Frmd6 T C 12: 70,934,663 (GRCm39) probably benign Het
Gmpr2 T C 14: 55,914,200 (GRCm39) probably benign Het
Hck G A 2: 152,980,215 (GRCm39) G348D probably damaging Het
Ifnab T A 4: 88,609,337 (GRCm39) Q43L possibly damaging Het
Ilkap A G 1: 91,314,937 (GRCm39) I142T possibly damaging Het
Lamc3 T C 2: 31,818,859 (GRCm39) S1206P probably damaging Het
Mfsd13a C T 19: 46,354,943 (GRCm39) T40I probably benign Het
Mid1 A C X: 168,769,090 (GRCm39) N215H probably damaging Het
Mkrn1 T C 6: 39,382,851 (GRCm39) T134A probably benign Het
Mmp9 T A 2: 164,795,262 (GRCm39) V628E probably damaging Het
Msi2 A T 11: 88,607,406 (GRCm39) V67D probably damaging Het
Ncapd3 T A 9: 26,969,236 (GRCm39) V630E probably damaging Het
Nkain1 A G 4: 130,537,316 (GRCm38) V73A probably damaging Het
Nphp4 T A 4: 152,587,383 (GRCm39) D245E probably damaging Het
Or14j3 T C 17: 37,900,655 (GRCm39) I196M probably benign Het
Or7a41 T G 10: 78,870,876 (GRCm39) M82R probably damaging Het
Or9g8 G A 2: 85,607,348 (GRCm39) C140Y probably benign Het
Pkd1l1 T C 11: 8,891,038 (GRCm39) probably benign Het
Plcxd1 A C 5: 110,250,096 (GRCm39) I184L probably damaging Het
Prl3b1 G A 13: 27,427,848 (GRCm39) A53T probably benign Het
Rasl10b G A 11: 83,308,665 (GRCm39) probably null Het
Scube2 A G 7: 109,403,821 (GRCm39) Y890H probably damaging Het
Slco6c1 T A 1: 97,055,928 (GRCm39) probably null Het
Tnfaip2 T G 12: 111,415,756 (GRCm39) F485V probably benign Het
Tpd52 T C 3: 9,028,993 (GRCm39) D17G probably damaging Het
Ube4b T C 4: 149,419,606 (GRCm39) D1034G probably damaging Het
Vmn2r118 G A 17: 55,900,237 (GRCm39) Q556* probably null Het
Zftraf1 T C 15: 76,533,169 (GRCm39) R190G probably damaging Het
Other mutations in Cir1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cir1 APN 2 73,118,068 (GRCm39) splice site probably null
IGL02969:Cir1 APN 2 73,134,120 (GRCm39) missense probably null 1.00
IGL03019:Cir1 APN 2 73,116,692 (GRCm39) missense unknown
magellanic UTSW 2 73,136,757 (GRCm39) splice site probably benign
penguin UTSW 2 73,142,823 (GRCm39) missense probably damaging 1.00
R0532:Cir1 UTSW 2 73,140,799 (GRCm39) critical splice donor site probably null
R1052:Cir1 UTSW 2 73,117,987 (GRCm39) missense probably damaging 1.00
R1752:Cir1 UTSW 2 73,140,882 (GRCm39) missense probably damaging 1.00
R2140:Cir1 UTSW 2 73,142,781 (GRCm39) missense probably damaging 1.00
R4740:Cir1 UTSW 2 73,142,867 (GRCm39) unclassified probably benign
R4954:Cir1 UTSW 2 73,140,848 (GRCm39) missense probably benign 0.40
R5096:Cir1 UTSW 2 73,134,105 (GRCm39) missense probably damaging 1.00
R5134:Cir1 UTSW 2 73,114,847 (GRCm39) nonsense probably null
R5821:Cir1 UTSW 2 73,142,804 (GRCm39) missense probably damaging 1.00
R7006:Cir1 UTSW 2 73,140,834 (GRCm39) missense probably damaging 0.99
R7183:Cir1 UTSW 2 73,116,730 (GRCm39) missense probably damaging 1.00
R7706:Cir1 UTSW 2 73,142,823 (GRCm39) missense probably damaging 1.00
R7724:Cir1 UTSW 2 73,137,234 (GRCm39) missense possibly damaging 0.85
R7921:Cir1 UTSW 2 73,140,799 (GRCm39) critical splice donor site probably null
R8922:Cir1 UTSW 2 73,118,053 (GRCm39) missense possibly damaging 0.94
R9514:Cir1 UTSW 2 73,142,781 (GRCm39) missense probably damaging 1.00
R9746:Cir1 UTSW 2 73,134,152 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGCACTGTTTGTAGGAGGTAAGTC -3'
(R):5'- TACTGGCAGAGGTACATTCAGCCC -3'

Sequencing Primer
(F):5'- TGGTCAGTGAACCTTAACAAGC -3'
(R):5'- TGGAAAGTCTACTCATTGCCAG -3'
Posted On 2014-02-11