Incidental Mutation 'R1366:Olfr1014'
ID156024
Institutional Source Beutler Lab
Gene Symbol Olfr1014
Ensembl Gene ENSMUSG00000059379
Gene Nameolfactory receptor 1014
SynonymsMOR213-5, GA_x6K02T2Q125-47255337-47256254
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85772713-85778974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85777004 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 140 (C140Y)
Ref Sequence ENSEMBL: ENSMUSP00000150352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076250] [ENSMUST00000213453] [ENSMUST00000216397]
Predicted Effect probably benign
Transcript: ENSMUST00000076250
AA Change: C140Y

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000075600
Gene: ENSMUSG00000059379
AA Change: C140Y

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.7e-50 PFAM
Pfam:7tm_1 40 289 8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213453
AA Change: C140Y

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215522
Predicted Effect probably benign
Transcript: ENSMUST00000216397
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Olfr1014
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1858:Olfr1014 UTSW 2 85777238 missense probably damaging 0.99
R1940:Olfr1014 UTSW 2 85777171 missense probably benign
R4868:Olfr1014 UTSW 2 85776626 missense possibly damaging 0.62
R4957:Olfr1014 UTSW 2 85777115 missense probably damaging 1.00
R5109:Olfr1014 UTSW 2 85777324 missense probably damaging 1.00
R5884:Olfr1014 UTSW 2 85777055 missense probably damaging 0.99
R7510:Olfr1014 UTSW 2 85776809 missense probably damaging 1.00
Z1088:Olfr1014 UTSW 2 85777122 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAATGACTCTAGGCTCCATACAC -3'
(R):5'- CTCTATCTAAAGAGTAGCTGGACCGGG -3'

Sequencing Primer
(F):5'- ATCTTAGTGACCTGCATCTCTGAAG -3'
(R):5'- TCCTCAAGATAGTGGCAATGATG -3'
Posted On2014-02-11