Incidental Mutation 'R1366:Tpd52'
ID156028
Institutional Source Beutler Lab
Gene Symbol Tpd52
Ensembl Gene ENSMUSG00000027506
Gene Nametumor protein D52
SynonymsmD52
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R1366 (G1)
Quality Score182
Status Validated
Chromosome3
Chromosomal Location8925593-9004723 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8963933 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000091943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063496] [ENSMUST00000091354] [ENSMUST00000091355] [ENSMUST00000094381] [ENSMUST00000120143] [ENSMUST00000121038] [ENSMUST00000124956] [ENSMUST00000134788] [ENSMUST00000145905] [ENSMUST00000155450]
Predicted Effect probably benign
Transcript: ENSMUST00000063496
SMART Domains Protein: ENSMUSP00000066826
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 180 2.8e-69 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000091354
AA Change: D17G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000088913
Gene: ENSMUSG00000027506
AA Change: D17G

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:TPD52 46 210 4.7e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091355
SMART Domains Protein: ENSMUSP00000088914
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 185 7.5e-70 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094381
AA Change: D17G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091943
Gene: ENSMUSG00000027506
AA Change: D17G

DomainStartEndE-ValueType
low complexity region 30 42 N/A INTRINSIC
Pfam:TPD52 48 232 1.3e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120143
SMART Domains Protein: ENSMUSP00000112830
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 7 171 2.4e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121038
SMART Domains Protein: ENSMUSP00000113368
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 1 148 2.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124956
SMART Domains Protein: ENSMUSP00000119077
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 1 77 8.8e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129736
Predicted Effect probably benign
Transcript: ENSMUST00000134788
SMART Domains Protein: ENSMUSP00000119899
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Pfam:TPD52 56 206 1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145905
SMART Domains Protein: ENSMUSP00000123147
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
Pfam:TPD52 4 168 8.3e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155450
SMART Domains Protein: ENSMUSP00000120317
Gene: ENSMUSG00000027506

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
transmembrane domain 36 55 N/A INTRINSIC
Meta Mutation Damage Score 0.0853 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Tpd52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Tpd52 APN 3 8947632 splice site probably null
IGL02662:Tpd52 APN 3 8944715 splice site probably null
IGL02994:Tpd52 APN 3 8947530 missense probably benign 0.00
R0319:Tpd52 UTSW 3 8953689 missense probably benign 0.00
R0960:Tpd52 UTSW 3 8943590 splice site probably null
R1828:Tpd52 UTSW 3 8947519 missense probably damaging 1.00
R1869:Tpd52 UTSW 3 8953802 splice site probably null
R2872:Tpd52 UTSW 3 9003406 nonsense probably null
R2872:Tpd52 UTSW 3 9003406 nonsense probably null
R4761:Tpd52 UTSW 3 8963873 missense probably damaging 1.00
R4907:Tpd52 UTSW 3 8944608 splice site probably null
R4997:Tpd52 UTSW 3 8934996 missense probably damaging 1.00
R5384:Tpd52 UTSW 3 8931195 intron probably null
R5385:Tpd52 UTSW 3 8931195 intron probably null
R5441:Tpd52 UTSW 3 9003406 nonsense probably null
R7154:Tpd52 UTSW 3 8963856 nonsense probably null
Z1177:Tpd52 UTSW 3 8931144 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATTTGACCCCAAGACCCTCCGTG -3'
(R):5'- CAGTGAATTAGCGACAGGTGGTGAC -3'

Sequencing Primer
(F):5'- CAGACGGTGCCAACTTTAAAATTC -3'
(R):5'- CTCCTAAGGGAGGAGTCACTAC -3'
Posted On2014-02-11