Incidental Mutation 'R1366:Ube4b'
ID156032
Institutional Source Beutler Lab
Gene Symbol Ube4b
Ensembl Gene ENSMUSG00000028960
Gene Nameubiquitination factor E4B
SynonymsUFD2a, 4930551I19Rik, Ufd2p, 4933406G05Rik, UFD2, D4Bwg0973e
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1366 (G1)
Quality Score166
Status Validated
Chromosome4
Chromosomal Location149328416-149426749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149335149 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1034 (D1034G)
Ref Sequence ENSEMBL: ENSMUSP00000099501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103212] [ENSMUST00000138181] [ENSMUST00000172836] [ENSMUST00000174343]
PDB Structure
U-box domain of the E3 Ubiquitin Ligase E4B [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000103212
AA Change: D1034G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099501
Gene: ENSMUSG00000028960
AA Change: D1034G

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 1083 1.3e-199 PFAM
Ubox 1102 1164 3.94e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138181
SMART Domains Protein: ENSMUSP00000122020
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
Pfam:Ufd2P_core 1 39 1.1e-7 PFAM
Ubox 57 119 3.94e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155968
Predicted Effect probably benign
Transcript: ENSMUST00000172836
SMART Domains Protein: ENSMUSP00000134452
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
low complexity region 439 452 N/A INTRINSIC
Pfam:Ufd2P_core 462 983 7.4e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174343
SMART Domains Protein: ENSMUSP00000134556
Gene: ENSMUSG00000028960

DomainStartEndE-ValueType
low complexity region 10 20 N/A INTRINSIC
low complexity region 21 33 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
low complexity region 76 99 N/A INTRINSIC
low complexity region 261 278 N/A INTRINSIC
Meta Mutation Damage Score 0.4915 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes an additional conjugation factor, E4, which is involved in multiubiquitin chain assembly. This gene is also the strongest candidate in the neuroblastoma tumor suppressor genes. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene die by midgestation and exhibit cardiac development defects such as hemorrhage and cardiomyocyte apoptosis. Heterozygous mice exhibit axonal dystrophy in the nucleus gracilis, degeneration of Purkinje cells and gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Ube4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Ube4b APN 4 149381366 missense probably benign 0.29
IGL00820:Ube4b APN 4 149352921 splice site probably benign
IGL01093:Ube4b APN 4 149330269 missense probably benign 0.01
IGL01154:Ube4b APN 4 149365470 missense probably benign 0.28
IGL01612:Ube4b APN 4 149383818 missense probably damaging 0.98
IGL01800:Ube4b APN 4 149331494 missense probably damaging 1.00
IGL02149:Ube4b APN 4 149398684 missense possibly damaging 0.88
IGL02472:Ube4b APN 4 149387079 critical splice donor site probably null
IGL02839:Ube4b APN 4 149368399 missense probably damaging 0.98
IGL03027:Ube4b APN 4 149381277 missense probably damaging 1.00
R0143:Ube4b UTSW 4 149355457 missense possibly damaging 0.61
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0164:Ube4b UTSW 4 149360324 missense probably damaging 0.98
R0206:Ube4b UTSW 4 149398637 missense probably benign 0.38
R0591:Ube4b UTSW 4 149357577 intron probably benign
R1452:Ube4b UTSW 4 149371169 missense probably damaging 1.00
R1513:Ube4b UTSW 4 149351578 missense probably benign 0.17
R1668:Ube4b UTSW 4 149361294 missense probably benign 0.02
R1874:Ube4b UTSW 4 149347971 missense probably damaging 1.00
R2002:Ube4b UTSW 4 149383797 missense probably benign 0.16
R2050:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R2109:Ube4b UTSW 4 149372841 missense probably benign 0.00
R2281:Ube4b UTSW 4 149344572 missense probably damaging 1.00
R3547:Ube4b UTSW 4 149335116 missense probably damaging 1.00
R3881:Ube4b UTSW 4 149365404 intron probably null
R4378:Ube4b UTSW 4 149383798 missense probably damaging 1.00
R4563:Ube4b UTSW 4 149359165 intron probably benign
R4674:Ube4b UTSW 4 149331370 missense possibly damaging 0.86
R4716:Ube4b UTSW 4 149344612 missense probably damaging 1.00
R5026:Ube4b UTSW 4 149360565 missense probably damaging 1.00
R5125:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5178:Ube4b UTSW 4 149342992 missense probably damaging 1.00
R5182:Ube4b UTSW 4 149381242 missense probably null 0.08
R5229:Ube4b UTSW 4 149387178 missense probably damaging 1.00
R5303:Ube4b UTSW 4 149383803 missense probably damaging 0.98
R5346:Ube4b UTSW 4 149337424 missense possibly damaging 0.91
R5780:Ube4b UTSW 4 149331364 missense probably benign 0.00
R5813:Ube4b UTSW 4 149337468 missense probably damaging 1.00
R5842:Ube4b UTSW 4 149331430 missense probably benign 0.01
R5994:Ube4b UTSW 4 149372932 missense probably damaging 0.97
R6020:Ube4b UTSW 4 149368311 missense probably benign 0.17
R6125:Ube4b UTSW 4 149398746 missense probably benign 0.13
R6272:Ube4b UTSW 4 149387133 missense probably damaging 1.00
R6333:Ube4b UTSW 4 149348037 missense probably damaging 1.00
R6426:Ube4b UTSW 4 149425996 unclassified probably benign
R7203:Ube4b UTSW 4 149398610 missense probably benign 0.30
R7341:Ube4b UTSW 4 149343001 missense probably damaging 1.00
R7672:Ube4b UTSW 4 149387204 missense probably benign 0.10
R7713:Ube4b UTSW 4 149398781 missense possibly damaging 0.53
Z1088:Ube4b UTSW 4 149335125 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGGAAGACCTGCAATTTCCTGACAC -3'
(R):5'- ATTGAGCAGCCCATTCCCACTG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- ACTTTGCAGCAGCTTGGAC -3'
Posted On2014-02-11