Incidental Mutation 'R1366:Nphp4'
ID156033
Institutional Source Beutler Lab
Gene Symbol Nphp4
Ensembl Gene ENSMUSG00000039577
Gene Namenephronophthisis 4 (juvenile) homolog (human)
Synonymsnmf192, 4930564O18Rik
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location152476706-152563183 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152502926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 245 (D245E)
Ref Sequence ENSEMBL: ENSMUSP00000080128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056567] [ENSMUST00000081393]
Predicted Effect probably damaging
Transcript: ENSMUST00000056567
AA Change: D245E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049920
Gene: ENSMUSG00000039577
AA Change: D245E

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081393
AA Change: D245E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080128
Gene: ENSMUSG00000039577
AA Change: D245E

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 367 380 N/A INTRINSIC
low complexity region 473 484 N/A INTRINSIC
low complexity region 507 530 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146223
Meta Mutation Damage Score 0.1421 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in renal tubular development and function. This protein interacts with nephrocystin, and belongs to a multifunctional complex that is localized to actin- and microtubule-based structures. Mutations in this gene are associated with nephronophthisis type 4, a renal disease, and with Senior-Loken syndrome type 4, a combination of nephronophthisis and retinitis pigmentosa. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mutant mice have a mottled retina with photoreceptor degeneration and male infertility associated with oligozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Nphp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Nphp4 APN 4 152537309 splice site probably benign
IGL00963:Nphp4 APN 4 152537861 missense probably benign 0.01
IGL01571:Nphp4 APN 4 152556382 missense probably benign 0.21
IGL01707:Nphp4 APN 4 152538983 missense probably benign 0.00
IGL01837:Nphp4 APN 4 152488881 missense probably damaging 0.96
IGL02341:Nphp4 APN 4 152555469 splice site probably benign
IGL02558:Nphp4 APN 4 152555531 missense probably damaging 1.00
IGL02563:Nphp4 APN 4 152556220 missense probably benign 0.00
IGL02712:Nphp4 APN 4 152556275 missense probably damaging 1.00
IGL03023:Nphp4 APN 4 152524235 splice site probably null
R0280:Nphp4 UTSW 4 152551936 splice site probably benign
R0317:Nphp4 UTSW 4 152551931 critical splice donor site probably null
R0410:Nphp4 UTSW 4 152557046 missense probably benign
R0433:Nphp4 UTSW 4 152518172 missense probably benign 0.00
R0706:Nphp4 UTSW 4 152555617 missense probably damaging 0.98
R0785:Nphp4 UTSW 4 152562109 missense possibly damaging 0.58
R0890:Nphp4 UTSW 4 152498220 missense possibly damaging 0.93
R0930:Nphp4 UTSW 4 152538055 missense probably benign 0.01
R1202:Nphp4 UTSW 4 152488729 splice site probably null
R1203:Nphp4 UTSW 4 152488832 missense probably damaging 0.96
R1452:Nphp4 UTSW 4 152547018 missense probably damaging 0.99
R1598:Nphp4 UTSW 4 152562090 missense probably benign 0.00
R1699:Nphp4 UTSW 4 152496664 missense probably damaging 0.99
R2007:Nphp4 UTSW 4 152554654 missense probably damaging 0.97
R2082:Nphp4 UTSW 4 152559364 missense probably benign 0.38
R2264:Nphp4 UTSW 4 152503008 splice site probably benign
R2280:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2281:Nphp4 UTSW 4 152557043 missense possibly damaging 0.95
R2926:Nphp4 UTSW 4 152518139 missense probably damaging 0.99
R3764:Nphp4 UTSW 4 152538017 splice site probably benign
R4084:Nphp4 UTSW 4 152488791 missense probably damaging 1.00
R4091:Nphp4 UTSW 4 152547018 missense probably damaging 0.97
R4240:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R4701:Nphp4 UTSW 4 152496659 missense probably damaging 1.00
R4778:Nphp4 UTSW 4 152556291 missense probably benign 0.44
R4783:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4784:Nphp4 UTSW 4 152554546 missense probably benign 0.00
R4974:Nphp4 UTSW 4 152537793 missense probably damaging 1.00
R5053:Nphp4 UTSW 4 152544462 splice site probably null
R5117:Nphp4 UTSW 4 152524232 splice site probably null
R5128:Nphp4 UTSW 4 152502991 missense probably benign 0.01
R5665:Nphp4 UTSW 4 152506485 missense probably benign 0.25
R5890:Nphp4 UTSW 4 152547079 missense probably benign 0.44
R6171:Nphp4 UTSW 4 152544449 missense probably damaging 0.99
R6601:Nphp4 UTSW 4 152503007 splice site probably null
R6772:Nphp4 UTSW 4 152544406 missense probably benign 0.07
R6806:Nphp4 UTSW 4 152538101 missense probably benign 0.02
R7006:Nphp4 UTSW 4 152488802 missense probably benign 0.12
R7124:Nphp4 UTSW 4 152555684 missense probably benign 0.07
R7381:Nphp4 UTSW 4 152499003 missense possibly damaging 0.94
R7411:Nphp4 UTSW 4 152554717 missense probably benign 0.25
R7638:Nphp4 UTSW 4 152554534 missense probably benign 0.08
R7814:Nphp4 UTSW 4 152524272 missense possibly damaging 0.93
R7814:Nphp4 UTSW 4 152544403 missense probably damaging 1.00
R7841:Nphp4 UTSW 4 152496683 missense probably benign 0.01
T0970:Nphp4 UTSW 4 152556379 missense probably damaging 1.00
X0058:Nphp4 UTSW 4 152559707 missense possibly damaging 0.95
Z1177:Nphp4 UTSW 4 152518196 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCAGTGAGCTGATCTCGTACC -3'
(R):5'- TGGGGAAAATGGCCCCTCCTAAAC -3'

Sequencing Primer
(F):5'- CCTTTAAGTCCCAACTATATACGGTG -3'
(R):5'- GGAAAGAAATGCCTTCCTCAGTC -3'
Posted On2014-02-11