Incidental Mutation 'R1366:4930548H24Rik'
ID156034
Institutional Source Beutler Lab
Gene Symbol 4930548H24Rik
Ensembl Gene ENSMUSG00000029138
Gene NameRIKEN cDNA 4930548H24 gene
Synonyms
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31485740-31488476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31487517 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 205 (C205S)
Ref Sequence ENSEMBL: ENSMUSP00000031020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031020]
Predicted Effect probably benign
Transcript: ENSMUST00000031020
AA Change: C205S

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031020
Gene: ENSMUSG00000029138
AA Change: C205S

DomainStartEndE-ValueType
coiled coil region 151 195 N/A INTRINSIC
Pfam:DUF4515 202 407 2e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202605
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in 4930548H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:4930548H24Rik APN 5 31487427 missense probably benign 0.00
IGL02009:4930548H24Rik APN 5 31487491 missense probably benign 0.00
FR4304:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4340:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4342:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4589:4930548H24Rik UTSW 5 31487373 small deletion probably benign
LCD18:4930548H24Rik UTSW 5 31487373 small deletion probably benign
PIT4486001:4930548H24Rik UTSW 5 31487743 missense probably damaging 0.99
R0650:4930548H24Rik UTSW 5 31485968 unclassified probably benign
R2050:4930548H24Rik UTSW 5 31486058 missense possibly damaging 0.68
R2070:4930548H24Rik UTSW 5 31487383 missense possibly damaging 0.91
R2862:4930548H24Rik UTSW 5 31485911 unclassified probably benign
R3965:4930548H24Rik UTSW 5 31487991 missense probably benign 0.02
R4299:4930548H24Rik UTSW 5 31487526 missense possibly damaging 0.82
R4634:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4635:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4637:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4887:4930548H24Rik UTSW 5 31486252 missense probably benign 0.19
R5587:4930548H24Rik UTSW 5 31486084 missense probably benign
R5897:4930548H24Rik UTSW 5 31485964 unclassified probably benign
R6181:4930548H24Rik UTSW 5 31488055 missense probably damaging 0.98
R6183:4930548H24Rik UTSW 5 31487976 missense probably damaging 0.99
RF006:4930548H24Rik UTSW 5 31487550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGGTTCTCCTCAGCCATCAACG -3'
(R):5'- TCCATTGACTGAAACTGCTGCTCC -3'

Sequencing Primer
(F):5'- AAATGAACTTTTCAAGTCAGAGAGGC -3'
(R):5'- TGAAACTGCTGCTCCAACTG -3'
Posted On2014-02-11