Incidental Mutation 'R1366:Mkrn1'
ID156038
Institutional Source Beutler Lab
Gene Symbol Mkrn1
Ensembl Gene ENSMUSG00000029922
Gene Namemakorin, ring finger protein, 1
Synonyms
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location39397804-39420462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39405917 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031985] [ENSMUST00000051671] [ENSMUST00000114822] [ENSMUST00000114823] [ENSMUST00000146785]
Predicted Effect probably benign
Transcript: ENSMUST00000031985
AA Change: T120A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031985
Gene: ENSMUSG00000029922
AA Change: T120A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 334 2.09e-7 SMART
low complexity region 349 363 N/A INTRINSIC
ZnF_C3H1 366 392 2.53e-2 SMART
Pfam:MKRN1_C 400 479 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051671
AA Change: T120A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000084244
Gene: ENSMUSG00000029922
AA Change: T120A

DomainStartEndE-ValueType
low complexity region 2 30 N/A INTRINSIC
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
ZnF_C3H1 208 234 1.13e-4 SMART
RING 281 328 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114822
AA Change: T120A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110470
Gene: ENSMUSG00000029922
AA Change: T120A

DomainStartEndE-ValueType
SCOP:d1gkub1 2 30 3e-3 SMART
low complexity region 35 54 N/A INTRINSIC
ZnF_C3H1 55 81 3.86e-7 SMART
ZnF_C3H1 85 110 8.27e-7 SMART
low complexity region 122 142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114823
AA Change: T56A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110471
Gene: ENSMUSG00000029922
AA Change: T56A

DomainStartEndE-ValueType
ZnF_C3H1 1 17 6.26e1 SMART
ZnF_C3H1 21 46 8.27e-7 SMART
low complexity region 58 78 N/A INTRINSIC
ZnF_C3H1 144 170 1.13e-4 SMART
RING 217 270 2.09e-7 SMART
low complexity region 285 299 N/A INTRINSIC
ZnF_C3H1 302 328 2.53e-2 SMART
low complexity region 378 395 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122874
Predicted Effect probably benign
Transcript: ENSMUST00000122996
AA Change: T134A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115231
Gene: ENSMUSG00000029922
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 75 96 4.11e-2 SMART
ZnF_C3H1 100 125 8.27e-7 SMART
low complexity region 137 157 N/A INTRINSIC
ZnF_C3H1 223 249 1.13e-4 SMART
RING 296 343 4.72e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146785
AA Change: T98A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123440
Gene: ENSMUSG00000029922
AA Change: T98A

DomainStartEndE-ValueType
ZnF_C3H1 34 59 1.56e-2 SMART
ZnF_C3H1 63 88 8.27e-7 SMART
low complexity region 100 120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150575
SMART Domains Protein: ENSMUSP00000121563
Gene: ENSMUSG00000029922

DomainStartEndE-ValueType
RING 52 105 2.09e-7 SMART
low complexity region 170 191 N/A INTRINSIC
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable and fertile, and show normal kidney morphology, eyelid development, and skeletal morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Mkrn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01921:Mkrn1 APN 6 39405913 missense possibly damaging 0.80
IGL03235:Mkrn1 APN 6 39401330 missense probably damaging 1.00
R0127:Mkrn1 UTSW 6 39399275 missense probably benign 0.19
R0445:Mkrn1 UTSW 6 39404854 missense probably benign 0.28
R1109:Mkrn1 UTSW 6 39399334 missense probably damaging 1.00
R1783:Mkrn1 UTSW 6 39400456 missense probably null
R2002:Mkrn1 UTSW 6 39405803 missense probably benign 0.00
R4671:Mkrn1 UTSW 6 39405757 missense probably damaging 1.00
R4889:Mkrn1 UTSW 6 39420005 unclassified probably benign
R7948:Mkrn1 UTSW 6 39400410 missense probably benign 0.17
RF016:Mkrn1 UTSW 6 39419991 missense
Z1088:Mkrn1 UTSW 6 39400456 missense probably null
Z1176:Mkrn1 UTSW 6 39400456 missense probably null
Z1177:Mkrn1 UTSW 6 39400456 missense probably null
Predicted Primers PCR Primer
(F):5'- GCTCAAACAGAAAAGGCTGACACTG -3'
(R):5'- GGAATAAGTCTTGACAGGTGCTCCC -3'

Sequencing Primer
(F):5'- TACTTACTACGGCCACAGTAGGG -3'
(R):5'- CTGCTCATGTTCACACTGAAG -3'
Posted On2014-02-11