Incidental Mutation 'R1366:Acsm1'
ID156040
Institutional Source Beutler Lab
Gene Symbol Acsm1
Ensembl Gene ENSMUSG00000033533
Gene Nameacyl-CoA synthetase medium-chain family member 1
SynonymsBucs1, Macs
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119607026-119662515 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 119658288 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047929] [ENSMUST00000135683]
Predicted Effect probably benign
Transcript: ENSMUST00000047929
SMART Domains Protein: ENSMUSP00000036140
Gene: ENSMUSG00000033533

DomainStartEndE-ValueType
Pfam:AMP-binding 58 471 8.1e-70 PFAM
Pfam:AMP-binding_C 479 559 1.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135683
SMART Domains Protein: ENSMUSP00000120146
Gene: ENSMUSG00000033533

DomainStartEndE-ValueType
Pfam:AMP-binding 58 371 6.8e-51 PFAM
Pfam:AMP-binding 368 444 9e-15 PFAM
Pfam:AMP-binding_C 452 531 5.4e-22 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Acsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:Acsm1 APN 7 119658301 missense possibly damaging 0.46
IGL02121:Acsm1 APN 7 119658412 missense possibly damaging 0.76
IGL02480:Acsm1 APN 7 119656042 missense possibly damaging 0.94
IGL02806:Acsm1 APN 7 119636638 missense probably benign 0.02
IGL03126:Acsm1 APN 7 119633180 missense possibly damaging 0.74
wallball UTSW 7 119640694 missense possibly damaging 0.83
R0025:Acsm1 UTSW 7 119658315 missense probably damaging 1.00
R0025:Acsm1 UTSW 7 119658315 missense probably damaging 1.00
R0090:Acsm1 UTSW 7 119662189 splice site probably benign
R0396:Acsm1 UTSW 7 119636455 missense probably damaging 1.00
R0491:Acsm1 UTSW 7 119640697 missense probably damaging 1.00
R0575:Acsm1 UTSW 7 119659201 critical splice donor site probably null
R1220:Acsm1 UTSW 7 119658314 missense probably benign 0.00
R1624:Acsm1 UTSW 7 119652573 missense probably damaging 1.00
R2049:Acsm1 UTSW 7 119656039 missense probably damaging 1.00
R2937:Acsm1 UTSW 7 119659127 missense probably damaging 1.00
R4657:Acsm1 UTSW 7 119640694 missense possibly damaging 0.83
R4814:Acsm1 UTSW 7 119655464 missense probably benign
R5153:Acsm1 UTSW 7 119640727 missense possibly damaging 0.72
R5329:Acsm1 UTSW 7 119656051 missense probably benign 0.03
R5471:Acsm1 UTSW 7 119660606 missense probably damaging 1.00
R5645:Acsm1 UTSW 7 119640697 missense probably damaging 1.00
R6153:Acsm1 UTSW 7 119633066 missense probably damaging 1.00
R6406:Acsm1 UTSW 7 119662261 missense probably benign 0.01
R7068:Acsm1 UTSW 7 119622580 missense probably benign
R7311:Acsm1 UTSW 7 119638082 missense probably damaging 1.00
Z1177:Acsm1 UTSW 7 119662278 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCAAAGGGAATTCACTACTGCTGC -3'
(R):5'- TAGGCTCTCACACATGGATGGCAC -3'

Sequencing Primer
(F):5'- CACTGAACATATCGCTAAGAATGG -3'
(R):5'- ccttgaaatcactctgttgcc -3'
Posted On2014-02-11