Incidental Mutation 'R1366:Ncapd3'
ID156042
Institutional Source Beutler Lab
Gene Symbol Ncapd3
Ensembl Gene ENSMUSG00000035024
Gene Namenon-SMC condensin II complex, subunit D3
Synonyms4632407J06Rik, B130055D15Rik, 2810487N22Rik
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location27030175-27095315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27057940 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 630 (V630E)
Ref Sequence ENSEMBL: ENSMUSP00000150938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]
Predicted Effect probably damaging
Transcript: ENSMUST00000073127
AA Change: V630E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: V630E

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cnd1 949 1148 1.7e-46 PFAM
low complexity region 1192 1200 N/A INTRINSIC
coiled coil region 1213 1270 N/A INTRINSIC
low complexity region 1290 1315 N/A INTRINSIC
low complexity region 1393 1410 N/A INTRINSIC
low complexity region 1485 1498 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086198
AA Change: V630E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024
AA Change: V630E

DomainStartEndE-ValueType
low complexity region 159 170 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Pfam:Cohesin_HEAT 536 560 4.6e-5 PFAM
Pfam:Cnd1 949 1148 6.6e-59 PFAM
low complexity region 1192 1200 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000216677
AA Change: V630E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8604 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Ncapd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Ncapd3 APN 9 27052353 missense probably benign
IGL00544:Ncapd3 APN 9 27063338 missense possibly damaging 0.94
IGL01657:Ncapd3 APN 9 27071824 missense possibly damaging 0.81
IGL01979:Ncapd3 APN 9 27071965 critical splice donor site probably null
IGL02073:Ncapd3 APN 9 27063316 missense probably benign 0.03
IGL02083:Ncapd3 APN 9 27051821 missense probably damaging 1.00
IGL02383:Ncapd3 APN 9 27050328 missense probably benign 0.44
IGL02429:Ncapd3 APN 9 27089302 missense probably benign 0.08
IGL02437:Ncapd3 APN 9 27063968 splice site probably benign
IGL02861:Ncapd3 APN 9 27069899 missense probably benign 0.00
IGL03202:Ncapd3 APN 9 27071715 splice site probably benign
IGL03219:Ncapd3 APN 9 27063873 splice site probably benign
IGL03252:Ncapd3 APN 9 27051449 missense probably damaging 1.00
pevensie UTSW 9 27086046 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0015:Ncapd3 UTSW 9 27051809 missense probably damaging 1.00
R0084:Ncapd3 UTSW 9 27056111 missense probably damaging 0.98
R0491:Ncapd3 UTSW 9 27057883 missense probably damaging 0.97
R0513:Ncapd3 UTSW 9 27064105 splice site probably benign
R0565:Ncapd3 UTSW 9 27087998 missense probably benign 0.00
R0601:Ncapd3 UTSW 9 27041507 missense probably benign 0.05
R0671:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0673:Ncapd3 UTSW 9 27087477 missense probably benign 0.00
R0842:Ncapd3 UTSW 9 27037084 missense probably benign 0.01
R1178:Ncapd3 UTSW 9 27041421 missense probably benign
R1432:Ncapd3 UTSW 9 27069872 splice site probably benign
R1439:Ncapd3 UTSW 9 27087566 critical splice donor site probably null
R1532:Ncapd3 UTSW 9 27083360 nonsense probably null
R2131:Ncapd3 UTSW 9 27083346 missense probably damaging 0.98
R2178:Ncapd3 UTSW 9 27088549 missense probably benign 0.01
R2238:Ncapd3 UTSW 9 27067024 missense probably benign
R2258:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2259:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2260:Ncapd3 UTSW 9 27056072 missense probably benign 0.16
R2297:Ncapd3 UTSW 9 27041501 nonsense probably null
R2877:Ncapd3 UTSW 9 27044487 splice site probably null
R3612:Ncapd3 UTSW 9 27050357 missense probably damaging 1.00
R3709:Ncapd3 UTSW 9 27052349 missense probably benign 0.00
R3791:Ncapd3 UTSW 9 27052635 missense probably benign 0.27
R4052:Ncapd3 UTSW 9 27089383 splice site probably null
R4297:Ncapd3 UTSW 9 27052327 missense probably benign
R4299:Ncapd3 UTSW 9 27052327 missense probably benign
R4441:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R4572:Ncapd3 UTSW 9 27094615 missense probably damaging 1.00
R4675:Ncapd3 UTSW 9 27094742 unclassified probably benign
R4790:Ncapd3 UTSW 9 27051850 missense probably benign 0.00
R4835:Ncapd3 UTSW 9 27086046 missense probably damaging 1.00
R4919:Ncapd3 UTSW 9 27051775 missense possibly damaging 0.95
R4928:Ncapd3 UTSW 9 27071735 nonsense probably null
R4939:Ncapd3 UTSW 9 27063869 critical splice donor site probably null
R4980:Ncapd3 UTSW 9 27063295 missense probably damaging 0.99
R5030:Ncapd3 UTSW 9 27071766 missense probably damaging 0.98
R5052:Ncapd3 UTSW 9 27051719 missense probably damaging 1.00
R5180:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5343:Ncapd3 UTSW 9 27088053 small deletion probably benign
R5656:Ncapd3 UTSW 9 27051645 missense possibly damaging 0.81
R5840:Ncapd3 UTSW 9 27094758 missense probably benign 0.00
R5900:Ncapd3 UTSW 9 27066969 missense probably benign 0.26
R6093:Ncapd3 UTSW 9 27056158 missense probably damaging 0.99
R6122:Ncapd3 UTSW 9 27063982 missense probably benign 0.00
R6249:Ncapd3 UTSW 9 27088053 small deletion probably benign
R6428:Ncapd3 UTSW 9 27052664 splice site probably null
R6432:Ncapd3 UTSW 9 27044509 missense probably damaging 0.98
R6441:Ncapd3 UTSW 9 27063416 missense probably benign 0.03
R6459:Ncapd3 UTSW 9 27051755 missense probably benign 0.00
R6567:Ncapd3 UTSW 9 27067004 missense possibly damaging 0.83
R6722:Ncapd3 UTSW 9 27087556 missense probably benign
R6862:Ncapd3 UTSW 9 27030809 missense probably damaging 0.98
R7234:Ncapd3 UTSW 9 27050359 missense probably damaging 0.97
R7286:Ncapd3 UTSW 9 27069958 missense probably damaging 1.00
R7404:Ncapd3 UTSW 9 27067019 missense probably benign 0.01
R7541:Ncapd3 UTSW 9 27067040 missense probably damaging 0.99
R7583:Ncapd3 UTSW 9 27071848 missense probably damaging 1.00
R7655:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7656:Ncapd3 UTSW 9 27055505 missense possibly damaging 0.47
R7815:Ncapd3 UTSW 9 27063440 nonsense probably null
R7876:Ncapd3 UTSW 9 27045223 critical splice donor site probably null
R7913:Ncapd3 UTSW 9 27048226 nonsense probably null
R8068:Ncapd3 UTSW 9 27063361 missense possibly damaging 0.66
R8147:Ncapd3 UTSW 9 27030718 start gained probably benign
R8197:Ncapd3 UTSW 9 27086033 missense probably damaging 0.98
R8264:Ncapd3 UTSW 9 27094742 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCTCATCATAAGCTAGAGGCTGC -3'
(R):5'- ACTCTGCTGTGGAACACATCCGTC -3'

Sequencing Primer
(F):5'- ttgttttggttttccttttgtttttg -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-02-11