Incidental Mutation 'R1366:Msi2'
ID156045
Institutional Source Beutler Lab
Gene Symbol Msi2
Ensembl Gene ENSMUSG00000069769
Gene Namemusashi RNA-binding protein 2
Synonymsmsi2h, Musashi2
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1366 (G1)
Quality Score159
Status Validated
Chromosome11
Chromosomal Location88339382-88718513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88716580 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 67 (V67D)
Ref Sequence ENSEMBL: ENSMUSP00000103542 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092794] [ENSMUST00000107908] [ENSMUST00000107909] [ENSMUST00000144699]
Predicted Effect probably damaging
Transcript: ENSMUST00000092794
AA Change: V67D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090470
Gene: ENSMUSG00000069769
AA Change: V67D

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
low complexity region 275 290 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107908
AA Change: V67D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103541
Gene: ENSMUSG00000069769
AA Change: V67D

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107909
AA Change: V67D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103542
Gene: ENSMUSG00000069769
AA Change: V67D

DomainStartEndE-ValueType
RRM 22 94 3.53e-24 SMART
RRM 111 183 1.62e-23 SMART
low complexity region 241 260 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126293
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138790
Predicted Effect probably damaging
Transcript: ENSMUST00000144699
AA Change: V45D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119684
Gene: ENSMUSG00000069769
AA Change: V45D

DomainStartEndE-ValueType
RRM 1 72 8.31e-21 SMART
internal_repeat_1 90 113 1.41e-5 PROSPERO
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is a member of the Musashi protein family. The encoded protein is transcriptional regulator that targets genes involved in development and cell cycle regulation. Mutations in this gene are associated with poor prognosis in certain types of cancers. This gene has also been shown to be rearranged in certain cancer cells. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit lethality, decreased body size, and decreased hematopoietic stem cells. Mice homozygous for a conditional knock-out allele exhibit impaired hematopoietic stem cell physiology upon induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Msi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mikimoto UTSW 11 88366784 critical splice donor site probably null
mixmaster UTSW 11 88716580 missense probably damaging 1.00
miyamoto UTSW 11 88716580 missense probably damaging 1.00
P0027:Msi2 UTSW 11 88394597 missense probably damaging 1.00
R2208:Msi2 UTSW 11 88590108 missense probably damaging 1.00
R2414:Msi2 UTSW 11 88716547 missense probably damaging 1.00
R4151:Msi2 UTSW 11 88718044 missense probably damaging 1.00
R4166:Msi2 UTSW 11 88347088 missense probably benign 0.29
R4494:Msi2 UTSW 11 88717359 missense possibly damaging 0.91
R4647:Msi2 UTSW 11 88718038 missense possibly damaging 0.83
R4952:Msi2 UTSW 11 88366784 critical splice donor site probably null
R4975:Msi2 UTSW 11 88394655 missense probably damaging 1.00
R5441:Msi2 UTSW 11 88479992 splice site probably benign
R5441:Msi2 UTSW 11 88718095 intron probably benign
R5715:Msi2 UTSW 11 88386063 missense probably damaging 1.00
R5768:Msi2 UTSW 11 88717738 missense probably damaging 1.00
R7297:Msi2 UTSW 11 88480038 missense probably damaging 0.97
R7505:Msi2 UTSW 11 88413917 missense possibly damaging 0.89
T0722:Msi2 UTSW 11 88394597 missense probably damaging 1.00
Z1176:Msi2 UTSW 11 88348792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAACTTCTGAGCCAACTCGC -3'
(R):5'- AGCATTTTCCAAGTTACCTCCAGCC -3'

Sequencing Primer
(F):5'- GTACCCAGTTCTAGCACAGAAG -3'
(R):5'- GGTATTTTTACCTCTTGAGGCAG -3'
Posted On2014-02-11