Incidental Mutation 'R1366:Tnfaip2'
ID156047
Institutional Source Beutler Lab
Gene Symbol Tnfaip2
Ensembl Gene ENSMUSG00000021281
Gene Nametumor necrosis factor, alpha-induced protein 2
SynonymsTnfaip2, tnfb94, Tnfip2
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1366 (G1)
Quality Score126
Status Validated
Chromosome12
Chromosomal Location111442469-111455018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 111449322 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 485 (F485V)
Ref Sequence ENSEMBL: ENSMUSP00000105415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102745] [ENSMUST00000109792] [ENSMUST00000129467] [ENSMUST00000172783] [ENSMUST00000174298]
Predicted Effect probably benign
Transcript: ENSMUST00000102745
AA Change: F468V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000099806
Gene: ENSMUSG00000021281
AA Change: F468V

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 688 1.3e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109792
AA Change: F485V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105415
Gene: ENSMUSG00000021281
AA Change: F485V

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
low complexity region 141 147 N/A INTRINSIC
Pfam:Sec6 157 705 1.7e-107 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127207
Predicted Effect probably benign
Transcript: ENSMUST00000129467
SMART Domains Protein: ENSMUSP00000133274
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156003
Predicted Effect probably benign
Transcript: ENSMUST00000172783
SMART Domains Protein: ENSMUSP00000133635
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
low complexity region 83 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173581
Predicted Effect probably benign
Transcript: ENSMUST00000174298
SMART Domains Protein: ENSMUSP00000133317
Gene: ENSMUSG00000021281

DomainStartEndE-ValueType
low complexity region 14 30 N/A INTRINSIC
low complexity region 42 54 N/A INTRINSIC
low complexity region 65 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221429
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression can be induced by the tumor necrosis factor alpha (TNF) in umbilical vein endothelial cells. The expression of this gene was shown to be induced by retinoic acid in a cell line expressing a oncogenic version of the retinoic acid receptor alpha fusion protein, which suggested that this gene may be a retinoic acid target gene in acute promyelocytic leukemia. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Tnfaip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Tnfaip2 APN 12 111453549 missense probably damaging 1.00
IGL01352:Tnfaip2 APN 12 111445619 missense probably damaging 1.00
IGL02550:Tnfaip2 APN 12 111446101 missense probably damaging 1.00
R0103:Tnfaip2 UTSW 12 111445810 missense probably benign 0.38
R0145:Tnfaip2 UTSW 12 111445858 missense possibly damaging 0.87
R0324:Tnfaip2 UTSW 12 111453459 missense probably damaging 1.00
R0609:Tnfaip2 UTSW 12 111453507 missense probably benign 0.01
R0837:Tnfaip2 UTSW 12 111450707 missense probably damaging 1.00
R1353:Tnfaip2 UTSW 12 111444969 missense probably damaging 1.00
R1988:Tnfaip2 UTSW 12 111449891 critical splice donor site probably null
R2109:Tnfaip2 UTSW 12 111448093 missense probably damaging 1.00
R2147:Tnfaip2 UTSW 12 111446022 missense probably damaging 1.00
R4003:Tnfaip2 UTSW 12 111451344 splice site probably benign
R4402:Tnfaip2 UTSW 12 111449851 missense probably benign 0.43
R4690:Tnfaip2 UTSW 12 111445248 missense possibly damaging 0.66
R4718:Tnfaip2 UTSW 12 111446029 missense possibly damaging 0.95
R5271:Tnfaip2 UTSW 12 111448460 intron probably benign
R6478:Tnfaip2 UTSW 12 111445663 missense probably damaging 1.00
R7623:Tnfaip2 UTSW 12 111445638 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTACTTTCTCACGCACCCTAGTG -3'
(R):5'- AGGCTCAGCAAGTTTCCTGTTCC -3'

Sequencing Primer
(F):5'- GGCTCCTCAGGTTTTGCAAC -3'
(R):5'- AGTCAATTGCATCCTGGTGACTC -3'
Posted On2014-02-11