Incidental Mutation 'R1366:Olfr114'
ID156052
Institutional Source Beutler Lab
Gene Symbol Olfr114
Ensembl Gene ENSMUSG00000062629
Gene Nameolfactory receptor 114
SynonymsMOR218-10, GA_x6K02T2PSCP-2049802-2048870
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37589233-37592743 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37589764 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 196 (I196M)
Ref Sequence ENSEMBL: ENSMUSP00000149735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076914] [ENSMUST00000214871] [ENSMUST00000216249]
Predicted Effect probably benign
Transcript: ENSMUST00000076914
AA Change: I196M

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000076181
Gene: ENSMUSG00000062629
AA Change: I196M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.7e-6 PFAM
Pfam:7tm_1 41 290 3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214871
AA Change: I196M

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216249
AA Change: I196M

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fam98a A G 17: 75,539,386 probably benign Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Olfr114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr114 APN 17 37590072 missense possibly damaging 0.93
IGL01624:Olfr114 APN 17 37589925 missense probably benign 0.00
IGL02026:Olfr114 APN 17 37589407 utr 3 prime probably benign
IGL02608:Olfr114 APN 17 37590219 missense probably damaging 1.00
IGL02632:Olfr114 APN 17 37590341 missense probably benign 0.00
IGL02990:Olfr114 APN 17 37589668 missense probably benign 0.00
R0114:Olfr114 UTSW 17 37589415 makesense probably null
R1156:Olfr114 UTSW 17 37589517 missense possibly damaging 0.93
R3413:Olfr114 UTSW 17 37589696 missense probably benign 0.00
R3701:Olfr114 UTSW 17 37589826 nonsense probably null
R6122:Olfr114 UTSW 17 37589926 missense probably benign 0.12
R6639:Olfr114 UTSW 17 37589931 missense probably damaging 1.00
R7066:Olfr114 UTSW 17 37590143 missense probably damaging 1.00
R7316:Olfr114 UTSW 17 37590135 missense probably damaging 0.99
R8340:Olfr114 UTSW 17 37590143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAAAGCAGTTGGAAAGTCTGAGGTTG -3'
(R):5'- TCTCCACTATGAGATCATCATGTGTCCC -3'

Sequencing Primer
(F):5'- GGTTTAGATATGCAAAGATGCCTG -3'
(R):5'- CATCATGTGTCCCAGAAAGTG -3'
Posted On2014-02-11