Incidental Mutation 'R1366:Fam98a'
ID156054
Institutional Source Beutler Lab
Gene Symbol Fam98a
Ensembl Gene ENSMUSG00000002017
Gene Namefamily with sequence similarity 98, member A
Synonyms2810405J04Rik
MMRRC Submission 039431-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R1366 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location75537086-75551946 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 75539386 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112507]
Predicted Effect probably benign
Transcript: ENSMUST00000112507
SMART Domains Protein: ENSMUSP00000108126
Gene: ENSMUSG00000002017

DomainStartEndE-ValueType
Pfam:DUF2465 11 328 1.1e-137 PFAM
low complexity region 334 396 N/A INTRINSIC
low complexity region 401 441 N/A INTRINSIC
low complexity region 448 481 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140729
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.1%
  • 10x: 92.3%
  • 20x: 80.8%
Validation Efficiency 93% (43/46)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik T A 5: 31,487,517 C205S probably benign Het
Aasdh A T 5: 76,888,804 S297T probably benign Het
Acsm1 T C 7: 119,658,288 probably benign Het
Ankar T A 1: 72,698,649 N125Y probably damaging Het
Chd1l T C 3: 97,581,149 D517G probably damaging Het
Cir1 A T 2: 73,306,413 probably benign Het
Cpxm1 G A 2: 130,396,122 R136W probably damaging Het
Cyhr1 T C 15: 76,648,969 R190G probably damaging Het
Dnah10 A T 5: 124,753,326 E761D probably benign Het
Fam186a T A 15: 99,943,389 E1658V possibly damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Frmd6 T C 12: 70,887,889 probably benign Het
Gmpr2 T C 14: 55,676,743 probably benign Het
Hck G A 2: 153,138,295 G348D probably damaging Het
Ifnab T A 4: 88,691,100 Q43L possibly damaging Het
Ilkap A G 1: 91,387,215 I142T possibly damaging Het
Lamc3 T C 2: 31,928,847 S1206P probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mid1 A C X: 169,986,094 N215H probably damaging Het
Mkrn1 T C 6: 39,405,917 T134A probably benign Het
Mmp9 T A 2: 164,953,342 V628E probably damaging Het
Msi2 A T 11: 88,716,580 V67D probably damaging Het
Ncapd3 T A 9: 27,057,940 V630E probably damaging Het
Nkain1 A G 4: 130,537,316 V73A probably damaging Het
Nphp4 T A 4: 152,502,926 D245E probably damaging Het
Olfr1014 G A 2: 85,777,004 C140Y probably benign Het
Olfr114 T C 17: 37,589,764 I196M probably benign Het
Olfr57 T G 10: 79,035,042 M82R probably damaging Het
Pkd1l1 T C 11: 8,941,038 probably benign Het
Plcxd1 A C 5: 110,102,230 I184L probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Rasl10b G A 11: 83,417,839 probably null Het
Scube2 A G 7: 109,804,614 Y890H probably damaging Het
Slco6c1 T A 1: 97,128,203 probably null Het
Tnfaip2 T G 12: 111,449,322 F485V probably benign Het
Tpd52 T C 3: 8,963,933 D17G probably damaging Het
Ube4b T C 4: 149,335,149 D1034G probably damaging Het
Vmn2r118 G A 17: 55,593,237 Q556* probably null Het
Other mutations in Fam98a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Fam98a APN 17 75551747 missense probably damaging 1.00
IGL00548:Fam98a APN 17 75538818 missense probably damaging 1.00
IGL02170:Fam98a APN 17 75540192 critical splice acceptor site probably null
IGL02399:Fam98a APN 17 75538941 splice site probably benign
IGL03062:Fam98a APN 17 75540105 splice site probably benign
IGL03246:Fam98a APN 17 75538853 missense probably damaging 0.99
R0584:Fam98a UTSW 17 75544777 missense probably damaging 1.00
R0594:Fam98a UTSW 17 75538487 nonsense probably null
R1121:Fam98a UTSW 17 75538534 missense unknown
R1387:Fam98a UTSW 17 75538269 missense unknown
R1424:Fam98a UTSW 17 75540178 missense probably damaging 1.00
R1533:Fam98a UTSW 17 75541281 missense probably damaging 1.00
R1651:Fam98a UTSW 17 75547715 missense probably benign 0.16
R2211:Fam98a UTSW 17 75538945 critical splice donor site probably null
R4295:Fam98a UTSW 17 75541347 missense probably damaging 1.00
R4350:Fam98a UTSW 17 75541225 missense probably damaging 1.00
R4963:Fam98a UTSW 17 75538982 missense probably damaging 0.99
R5320:Fam98a UTSW 17 75538815 missense probably damaging 1.00
R5383:Fam98a UTSW 17 75538581 missense unknown
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R7058:Fam98a UTSW 17 75538389 missense unknown
R7182:Fam98a UTSW 17 75539018 nonsense probably null
R7505:Fam98a UTSW 17 75538238 missense unknown
R7554:Fam98a UTSW 17 75547675 nonsense probably null
R7566:Fam98a UTSW 17 75547662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTTTAGGCGACAAGAGTGAGCG -3'
(R):5'- ACATATTAGCCAGTGGGAAGGACCG -3'

Sequencing Primer
(F):5'- GTCTGTCTGACTCTGTTGAAAC -3'
(R):5'- TTCTTTAAGAACAGGGGATCAAGC -3'
Posted On2014-02-11