Incidental Mutation 'R1367:Slc41a1'
ID156056
Institutional Source Beutler Lab
Gene Symbol Slc41a1
Ensembl Gene ENSMUSG00000013275
Gene Namesolute carrier family 41, member 1
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location131827493-131848865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131844008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 387 (T387A)
Ref Sequence ENSEMBL: ENSMUSP00000083747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086559]
Predicted Effect probably benign
Transcript: ENSMUST00000086559
AA Change: T387A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000083747
Gene: ENSMUSG00000013275
AA Change: T387A

DomainStartEndE-ValueType
transmembrane domain 97 119 N/A INTRINSIC
Pfam:MgtE 138 272 1.9e-25 PFAM
transmembrane domain 283 305 N/A INTRINSIC
transmembrane domain 314 336 N/A INTRINSIC
Pfam:MgtE 352 496 1.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146360
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Slc41a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Slc41a1 APN 1 131839176 missense probably damaging 1.00
IGL01368:Slc41a1 APN 1 131839124 missense probably damaging 0.99
R0255:Slc41a1 UTSW 1 131843912 splice site probably benign
R0737:Slc41a1 UTSW 1 131840952 missense probably damaging 1.00
R1474:Slc41a1 UTSW 1 131846581 missense probably damaging 0.98
R1927:Slc41a1 UTSW 1 131841200 missense probably damaging 0.99
R4518:Slc41a1 UTSW 1 131839125 missense probably damaging 0.99
R4790:Slc41a1 UTSW 1 131830952 missense probably damaging 1.00
R4851:Slc41a1 UTSW 1 131830770 missense probably benign 0.02
R5180:Slc41a1 UTSW 1 131844377 missense probably damaging 0.99
R5633:Slc41a1 UTSW 1 131846587 missense possibly damaging 0.68
R6060:Slc41a1 UTSW 1 131840234 missense probably benign 0.04
R6526:Slc41a1 UTSW 1 131841149 missense probably damaging 1.00
R6787:Slc41a1 UTSW 1 131842749 splice site probably null
R7038:Slc41a1 UTSW 1 131842057 missense possibly damaging 0.60
R7258:Slc41a1 UTSW 1 131842042 missense probably benign 0.27
R7382:Slc41a1 UTSW 1 131846632 missense probably damaging 1.00
R7405:Slc41a1 UTSW 1 131839146 missense probably damaging 1.00
R7432:Slc41a1 UTSW 1 131830956 missense probably damaging 1.00
R7574:Slc41a1 UTSW 1 131839151 missense probably damaging 1.00
R7873:Slc41a1 UTSW 1 131830823 missense possibly damaging 0.62
R7942:Slc41a1 UTSW 1 131840897 missense probably damaging 0.99
R7956:Slc41a1 UTSW 1 131844028 missense possibly damaging 0.53
Z1177:Slc41a1 UTSW 1 131843986 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACAAGGTGTTTTCCTCCCGGTC -3'
(R):5'- TGGAGCAGTGCAGCAGTCATGTAG -3'

Sequencing Primer
(F):5'- CCTTCCTCCTCCAAGTCTGAG -3'
(R):5'- AACGCCGTATTCTAGGTCAG -3'
Posted On2014-02-11