Incidental Mutation 'R1367:Cep170'
ID156058
Institutional Source Beutler Lab
Gene Symbol Cep170
Ensembl Gene ENSMUSG00000057335
Gene Namecentrosomal protein 170
Synonyms4933426L22Rik, A330004A13Rik
MMRRC Submission 039432-MU
Accession Numbers

Ncbi RefSeq: NM_001099637.2; MGI:1918348

Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location176733653-176814067 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 176735724 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 1575 (F1575L)
Ref Sequence ENSEMBL: ENSMUSP00000141793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057037] [ENSMUST00000192927] [ENSMUST00000194727] [ENSMUST00000195433] [ENSMUST00000195717]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057037
AA Change: F1565L

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059562
Gene: ENSMUSG00000057335
AA Change: F1565L

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 801 1496 3.3e-264 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192664
Predicted Effect probably benign
Transcript: ENSMUST00000192927
AA Change: F774L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000142032
Gene: ENSMUSG00000057335
AA Change: F774L

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Pfam:CEP170_C 30 469 3.4e-129 PFAM
Pfam:CEP170_C 449 708 7.4e-102 PFAM
low complexity region 742 754 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000192991
AA Change: F332L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194489
Predicted Effect probably damaging
Transcript: ENSMUST00000194727
AA Change: F1575L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141793
Gene: ENSMUSG00000057335
AA Change: F1575L

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1509 8e-260 PFAM
low complexity region 1543 1555 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194984
Predicted Effect probably benign
Transcript: ENSMUST00000195433
SMART Domains Protein: ENSMUSP00000142108
Gene: ENSMUSG00000057335

DomainStartEndE-ValueType
FHA 22 73 6.1e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195717
AA Change: F1565L

PolyPhen 2 Score 0.484 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141769
Gene: ENSMUSG00000057335
AA Change: F1565L

DomainStartEndE-ValueType
FHA 22 73 1.27e-7 SMART
low complexity region 118 133 N/A INTRINSIC
low complexity region 717 731 N/A INTRINSIC
low complexity region 738 750 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
Pfam:CEP170_C 795 1499 1.8e-261 PFAM
low complexity region 1533 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a component of the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. During interphase, the encoded protein localizes to the sub-distal appendages of mature centrioles, which are microtubule-based structures thought to help organize centrosomes. During mitosis, the protein associates with spindle microtubules near the centrosomes. The protein interacts with and is phosphorylated by polo-like kinase 1, and functions in maintaining microtubule organization and cell morphology. The human genome contains a putative transcribed pseudogene. Several alternatively spliced transcript variants of this gene have been found, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(29) : Gene trapped(29)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Cep170
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cep170 APN 1 176755399 missense probably damaging 1.00
IGL00925:Cep170 APN 1 176793524 missense probably damaging 1.00
IGL00972:Cep170 APN 1 176735696 missense probably benign 0.00
IGL01488:Cep170 APN 1 176756375 missense probably benign 0.00
IGL01916:Cep170 APN 1 176739910 splice site probably benign
IGL02212:Cep170 APN 1 176735936 missense probably damaging 0.99
IGL02269:Cep170 APN 1 176769366 missense probably benign
IGL02732:Cep170 APN 1 176736874 missense probably damaging 1.00
IGL02740:Cep170 APN 1 176793600 missense probably damaging 1.00
IGL02812:Cep170 APN 1 176742514 missense probably damaging 1.00
IGL03036:Cep170 APN 1 176769337 missense possibly damaging 0.87
IGL03201:Cep170 APN 1 176736888 missense probably damaging 1.00
IGL03333:Cep170 APN 1 176769526 missense possibly damaging 0.64
PIT4520001:Cep170 UTSW 1 176780199 missense unknown
R0031:Cep170 UTSW 1 176756091 missense probably damaging 1.00
R0039:Cep170 UTSW 1 176782495 critical splice donor site probably null
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0053:Cep170 UTSW 1 176782380 missense possibly damaging 0.82
R0113:Cep170 UTSW 1 176758455 missense probably damaging 0.97
R0144:Cep170 UTSW 1 176792595 missense probably benign 0.01
R0613:Cep170 UTSW 1 176774680 missense probably benign
R0755:Cep170 UTSW 1 176755753 missense probably damaging 1.00
R1132:Cep170 UTSW 1 176750037 missense probably damaging 1.00
R1399:Cep170 UTSW 1 176758403 missense probably damaging 0.98
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1462:Cep170 UTSW 1 176756645 missense possibly damaging 0.46
R1481:Cep170 UTSW 1 176782385 missense possibly damaging 0.56
R1526:Cep170 UTSW 1 176788505 missense probably damaging 1.00
R1540:Cep170 UTSW 1 176739932 missense probably damaging 1.00
R1552:Cep170 UTSW 1 176782494 splice site probably benign
R1570:Cep170 UTSW 1 176755801 missense possibly damaging 0.64
R1846:Cep170 UTSW 1 176755769 missense probably damaging 1.00
R1884:Cep170 UTSW 1 176774679 missense probably benign 0.12
R1945:Cep170 UTSW 1 176793534 nonsense probably null
R1954:Cep170 UTSW 1 176756384 missense probably benign
R1957:Cep170 UTSW 1 176769447 missense probably benign 0.24
R2184:Cep170 UTSW 1 176756976 missense probably benign 0.00
R2280:Cep170 UTSW 1 176774505 missense probably benign 0.17
R2426:Cep170 UTSW 1 176774635 missense probably benign
R3415:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3417:Cep170 UTSW 1 176756044 missense probably damaging 1.00
R3752:Cep170 UTSW 1 176782495 critical splice donor site probably benign
R3848:Cep170 UTSW 1 176755843 missense probably benign 0.14
R3849:Cep170 UTSW 1 176755843 missense probably benign 0.14
R4752:Cep170 UTSW 1 176756688 missense probably benign 0.00
R4910:Cep170 UTSW 1 176782263 missense possibly damaging 0.94
R5007:Cep170 UTSW 1 176769814 missense probably benign 0.28
R5052:Cep170 UTSW 1 176793551 missense probably damaging 1.00
R5093:Cep170 UTSW 1 176769330 missense possibly damaging 0.95
R5530:Cep170 UTSW 1 176769510 missense probably benign 0.00
R5622:Cep170 UTSW 1 176735867 missense possibly damaging 0.64
R5892:Cep170 UTSW 1 176755387 unclassified probably null
R5942:Cep170 UTSW 1 176756419 missense probably damaging 1.00
R6083:Cep170 UTSW 1 176774625 missense probably damaging 1.00
R6091:Cep170 UTSW 1 176755831 missense probably damaging 0.98
R6190:Cep170 UTSW 1 176782409 missense probably damaging 1.00
R6253:Cep170 UTSW 1 176780394 missense possibly damaging 0.71
R6476:Cep170 UTSW 1 176780351 missense possibly damaging 0.72
R6622:Cep170 UTSW 1 176756332 missense probably damaging 1.00
R6932:Cep170 UTSW 1 176761437 missense possibly damaging 0.90
R7030:Cep170 UTSW 1 176756485 missense probably damaging 0.99
R7163:Cep170 UTSW 1 176774465 missense probably damaging 1.00
R7352:Cep170 UTSW 1 176769857 missense probably benign 0.11
R7499:Cep170 UTSW 1 176774462 missense probably damaging 1.00
R7502:Cep170 UTSW 1 176756029 missense probably damaging 1.00
R7773:Cep170 UTSW 1 176740076 missense
R8043:Cep170 UTSW 1 176769242 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCCGATATAAGCTGCCTCTGCTG -3'
(R):5'- GGGATTTCCCAATGCTATCCTGCC -3'

Sequencing Primer
(F):5'- GGTTTGAAAAGACTGGTGTGAC -3'
(R):5'- AATGCTATCCTGCCATCTCCAC -3'
Posted On2014-02-11