Incidental Mutation 'R1367:Gid8'
ID156062
Institutional Source Beutler Lab
Gene Symbol Gid8
Ensembl Gene ENSMUSG00000027573
Gene NameGID complex subunit 8
Synonyms4833420G11Rik, 2310003C23Rik
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180710117-180718733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180713232 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 10 (I10M)
Ref Sequence ENSEMBL: ENSMUSP00000077753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029090] [ENSMUST00000078687] [ENSMUST00000103055] [ENSMUST00000103057]
Predicted Effect probably benign
Transcript: ENSMUST00000029090
AA Change: I10M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000029090
Gene: ENSMUSG00000027573
AA Change: I10M

DomainStartEndE-ValueType
LisH 25 57 5.89e-9 SMART
CTLH 63 120 6.06e-20 SMART
CRA 116 212 8.11e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078687
AA Change: I10M

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000077753
Gene: ENSMUSG00000027573
AA Change: I10M

DomainStartEndE-ValueType
LisH 25 57 5.89e-9 SMART
CTLH 63 120 6.06e-20 SMART
CRA 116 212 8.11e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103055
SMART Domains Protein: ENSMUSP00000099344
Gene: ENSMUSG00000038914

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103057
SMART Domains Protein: ENSMUSP00000099346
Gene: ENSMUSG00000038914

DomainStartEndE-ValueType
low complexity region 134 155 N/A INTRINSIC
PHD 267 317 1.19e-11 SMART
low complexity region 430 446 N/A INTRINSIC
TFS2M 669 770 1.16e-45 SMART
low complexity region 937 962 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
Pfam:SPOC 1052 1158 4.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150067
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Gid8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03139:Gid8 APN 2 180714708 missense probably damaging 1.00
R0098:Gid8 UTSW 2 180714735 missense possibly damaging 0.88
R0098:Gid8 UTSW 2 180714735 missense possibly damaging 0.88
R0485:Gid8 UTSW 2 180713211 nonsense probably null
R2156:Gid8 UTSW 2 180716958 missense probably benign 0.20
R7002:Gid8 UTSW 2 180713303 missense possibly damaging 0.90
R7358:Gid8 UTSW 2 180717986 missense probably benign 0.03
R8432:Gid8 UTSW 2 180714861 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCCACAGAGGAGTTGAAGACTCCA -3'
(R):5'- CTCCAGGGGTAAAGGGCCACTA -3'

Sequencing Primer
(F):5'- tcagaaatccgcctgcc -3'
(R):5'- CTAGTGTGAAAAGGGAGAGCTATG -3'
Posted On2014-02-11