Incidental Mutation 'R1367:Glrb'
ID156063
Institutional Source Beutler Lab
Gene Symbol Glrb
Ensembl Gene ENSMUSG00000028020
Gene Nameglycine receptor, beta subunit
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1367 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location80843599-80913660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80862004 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 139 (W139R)
Ref Sequence ENSEMBL: ENSMUSP00000142306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029654] [ENSMUST00000107743] [ENSMUST00000132330] [ENSMUST00000135043] [ENSMUST00000194085]
Predicted Effect probably damaging
Transcript: ENSMUST00000029654
AA Change: W139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029654
Gene: ENSMUSG00000028020
AA Change: W139R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 6.9e-55 PFAM
Pfam:Neur_chan_memb 273 492 4.2e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107743
AA Change: W139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103372
Gene: ENSMUSG00000028020
AA Change: W139R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 266 5.7e-58 PFAM
Pfam:Neur_chan_memb 273 302 9.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132330
SMART Domains Protein: ENSMUSP00000115014
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135043
SMART Domains Protein: ENSMUSP00000116604
Gene: ENSMUSG00000028020

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193031
Predicted Effect probably damaging
Transcript: ENSMUST00000194085
AA Change: W139R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142306
Gene: ENSMUSG00000028020
AA Change: W139R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
Pfam:Neur_chan_LBD 56 264 6.9e-55 PFAM
Pfam:Neur_chan_memb 248 441 1.1e-22 PFAM
Meta Mutation Damage Score 0.9357 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the glycine receptor, which is a pentamer composed of alpha and beta subunits. The receptor functions as a neurotransmitter-gated ion channel, which produces hyperpolarization via increased chloride conductance due to the binding of glycine to the receptor. This gene is transcribed throughout the central nervous system of neonatal and adult mice. In humans, mutations in this gene cause startle disease, also known as hereditary hyperekplexia or congenital stiff-person syndrome, a disease characterized by muscular rigidity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mutations in this gene result in a neurological disorder and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Glrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Glrb APN 3 80861955 missense probably damaging 1.00
IGL00850:Glrb APN 3 80861781 missense probably damaging 1.00
IGL01970:Glrb APN 3 80861925 missense possibly damaging 0.92
IGL02023:Glrb APN 3 80850955 missense probably benign 0.22
IGL02494:Glrb APN 3 80845232 missense probably benign 0.01
IGL02703:Glrb APN 3 80850993 missense probably benign 0.19
I1329:Glrb UTSW 3 80862074 missense probably damaging 1.00
R0003:Glrb UTSW 3 80855914 missense probably damaging 1.00
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0010:Glrb UTSW 3 80860315 splice site probably benign
R0743:Glrb UTSW 3 80879680 missense probably damaging 1.00
R1491:Glrb UTSW 3 80911975 missense possibly damaging 0.81
R1699:Glrb UTSW 3 80861774 missense probably damaging 1.00
R1791:Glrb UTSW 3 80860175 missense probably damaging 1.00
R1802:Glrb UTSW 3 80861957 missense probably damaging 1.00
R2420:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2422:Glrb UTSW 3 80860235 missense probably damaging 0.97
R2517:Glrb UTSW 3 80861747 missense probably damaging 1.00
R3612:Glrb UTSW 3 80862030 missense possibly damaging 0.89
R4287:Glrb UTSW 3 80845232 missense possibly damaging 0.84
R4382:Glrb UTSW 3 80879639 missense probably damaging 1.00
R4546:Glrb UTSW 3 80879686 missense probably damaging 0.99
R4874:Glrb UTSW 3 80851042 missense possibly damaging 0.84
R5816:Glrb UTSW 3 80861979 missense probably damaging 1.00
R5826:Glrb UTSW 3 80845142 missense probably damaging 0.99
R6711:Glrb UTSW 3 80844974 missense probably benign 0.02
R7738:Glrb UTSW 3 80860184 missense probably damaging 0.98
R8206:Glrb UTSW 3 80851066 missense probably damaging 1.00
Z1088:Glrb UTSW 3 80845234 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TGGAATCATTGAGCGTACATCGCTG -3'
(R):5'- GCAGGAAGAGCCACTGGTATCTTTAG -3'

Sequencing Primer
(F):5'- GTACATCGCTGAGATCCACTG -3'
(R):5'- GTAAAAATCACATGTCATGCCTGC -3'
Posted On2014-02-11