Incidental Mutation 'R1367:F3'
ID156064
Institutional Source Beutler Lab
Gene Symbol F3
Ensembl Gene ENSMUSG00000028128
Gene Namecoagulation factor III
SynonymsTF, Cf3, tissue factor, Cf-3, CD142
MMRRC Submission 039432-MU
Accession Numbers

Genbank: NM_010171

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1367 (G1)
Quality Score157
Status Validated
Chromosome3
Chromosomal Location121723537-121735048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121729374 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 78 (T78A)
Ref Sequence ENSEMBL: ENSMUSP00000029771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029771]
Predicted Effect probably damaging
Transcript: ENSMUST00000029771
AA Change: T78A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029771
Gene: ENSMUSG00000028128
AA Change: T78A

DomainStartEndE-ValueType
Pfam:Tissue_fac 12 110 1.1e-26 PFAM
Pfam:Interfer-bind 138 245 5.1e-26 PFAM
transmembrane domain 253 275 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197731
Predicted Effect probably benign
Transcript: ENSMUST00000199997
Meta Mutation Damage Score 0.7144 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a membrane-bound glycoprotein that forms the primary physiological initiator of the blood coagulation process following vascular damage. The encoded protein binds to coagulation factor VIIa and the ensuing complex catalyzes the proteolytic activation of coagulation factors IX and X. Mice lacking encoded protein die in utero resulting from massive hemorrhaging in both extraembryonic and embryonic vessels. A severe deficiency of the encoded protein in mice results in impaired uterine homeostasis, shorter life spans due to spontaneous fatal hemorrhages and cardiac fibrosis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired blood vessel development, retarded growth, and, in most cases, midgestational lethality. On a mixed background, some mutants survive to birth and appear to be normal. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Targeted, other(2)

Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in F3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02506:F3 APN 3 121731674 missense possibly damaging 0.83
G5030:F3 UTSW 3 121724999 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0020:F3 UTSW 3 121731616 missense probably damaging 1.00
R0622:F3 UTSW 3 121725019 missense probably damaging 1.00
R1371:F3 UTSW 3 121732510 missense probably damaging 1.00
R1925:F3 UTSW 3 121729383 missense probably damaging 1.00
R2100:F3 UTSW 3 121732433 missense possibly damaging 0.61
R2366:F3 UTSW 3 121732545 splice site probably null
R2471:F3 UTSW 3 121725040 missense probably damaging 1.00
R4577:F3 UTSW 3 121734114 missense probably benign 0.02
R5752:F3 UTSW 3 121732404 missense probably damaging 1.00
R6440:F3 UTSW 3 121725037 missense probably damaging 1.00
R6713:F3 UTSW 3 121731674 missense possibly damaging 0.83
R6845:F3 UTSW 3 121732475 missense probably benign 0.02
R6867:F3 UTSW 3 121729371 missense possibly damaging 0.93
R7145:F3 UTSW 3 121731586 missense probably damaging 1.00
R7511:F3 UTSW 3 121731557 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGGTGTAACGAAGCAAACAAACCC -3'
(R):5'- TTTGTAAATGGCGGCTCCTCCC -3'

Sequencing Primer
(F):5'- aaaacaaaaccaaataaaaGGTGCCC -3'
(R):5'- CCATGAATCACAAGTTGGTCTC -3'
Posted On2014-02-11