Incidental Mutation 'R1367:Ugt2b38'
ID156069
Institutional Source Beutler Lab
Gene Symbol Ugt2b38
Ensembl Gene ENSMUSG00000061906
Gene NameUDP glucuronosyltransferase 2 family, polypeptide B38
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1367 (G1)
Quality Score193
Status Not validated
Chromosome5
Chromosomal Location87409942-87424203 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87424114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 20 (S20T)
Ref Sequence ENSEMBL: ENSMUSP00000072598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072818]
Predicted Effect probably benign
Transcript: ENSMUST00000072818
AA Change: S20T

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000072598
Gene: ENSMUSG00000061906
AA Change: S20T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 527 4.1e-255 PFAM
Pfam:Glyco_tran_28_C 330 444 1.2e-7 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gga2 G A 7: 121,998,915 R319* probably null Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Ugt2b38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Ugt2b38 APN 5 87411823 missense probably damaging 1.00
IGL02326:Ugt2b38 APN 5 87423733 missense probably damaging 1.00
IGL02537:Ugt2b38 APN 5 87421731 missense possibly damaging 0.91
IGL02543:Ugt2b38 APN 5 87423483 missense probably benign 0.00
IGL02852:Ugt2b38 APN 5 87411741 missense probably benign
IGL03008:Ugt2b38 APN 5 87412423 missense probably benign 0.00
over_easy UTSW 5 87423742 missense probably benign 0.25
R0089:Ugt2b38 UTSW 5 87420558 missense probably benign 0.00
R0647:Ugt2b38 UTSW 5 87423469 missense probably benign 0.00
R0731:Ugt2b38 UTSW 5 87420452 missense probably damaging 1.00
R0837:Ugt2b38 UTSW 5 87411773 missense probably damaging 1.00
R0966:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0969:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0970:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R0971:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1068:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1070:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1071:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1073:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1133:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1134:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1383:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1467:Ugt2b38 UTSW 5 87412373 missense probably damaging 1.00
R1565:Ugt2b38 UTSW 5 87411914 missense probably damaging 0.99
R1691:Ugt2b38 UTSW 5 87424132 missense probably benign
R1725:Ugt2b38 UTSW 5 87411871 missense probably damaging 1.00
R1736:Ugt2b38 UTSW 5 87423633 missense probably benign
R2230:Ugt2b38 UTSW 5 87421668 missense probably benign 0.05
R2419:Ugt2b38 UTSW 5 87423732 missense probably damaging 1.00
R2496:Ugt2b38 UTSW 5 87421692 missense probably damaging 1.00
R3196:Ugt2b38 UTSW 5 87410219 missense probably damaging 0.96
R3773:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R5125:Ugt2b38 UTSW 5 87411812 missense probably damaging 1.00
R5224:Ugt2b38 UTSW 5 87423742 missense probably benign 0.25
R5516:Ugt2b38 UTSW 5 87411843 missense probably damaging 1.00
R5765:Ugt2b38 UTSW 5 87424095 missense probably damaging 0.99
R6352:Ugt2b38 UTSW 5 87424001 missense possibly damaging 0.73
R7166:Ugt2b38 UTSW 5 87410446 missense probably damaging 1.00
R7210:Ugt2b38 UTSW 5 87410425 missense probably damaging 0.99
R7291:Ugt2b38 UTSW 5 87411895 missense probably damaging 1.00
R7483:Ugt2b38 UTSW 5 87424114 missense probably damaging 0.96
R7969:Ugt2b38 UTSW 5 87424032 missense probably benign 0.02
R8118:Ugt2b38 UTSW 5 87423771 missense probably damaging 1.00
R8239:Ugt2b38 UTSW 5 87423800 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGCACATCAAACTTGGATTCCTGTAGC -3'
(R):5'- TCAGAGACCAGCCATATTATGAGGTCAC -3'

Sequencing Primer
(F):5'- TGACAAACATGTATCCCTTGGC -3'
(R):5'- CATGAATCACTCTCATGTAAACAGG -3'
Posted On2014-02-11