Incidental Mutation 'R1367:Gga2'
ID156073
Institutional Source Beutler Lab
Gene Symbol Gga2
Ensembl Gene ENSMUSG00000030872
Gene Namegolgi associated, gamma adaptin ear containing, ARF binding protein 2
Synonyms
MMRRC Submission 039432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1367 (G1)
Quality Score182
Status Validated
Chromosome7
Chromosomal Location121986722-122021222 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 121998915 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 319 (R319*)
Ref Sequence ENSEMBL: ENSMUSP00000115581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033160] [ENSMUST00000124566]
Predicted Effect probably null
Transcript: ENSMUST00000033160
AA Change: R319*
SMART Domains Protein: ENSMUSP00000033160
Gene: ENSMUSG00000030872
AA Change: R319*

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 241 318 2.2e-20 PFAM
low complexity region 320 338 N/A INTRINSIC
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect probably null
Transcript: ENSMUST00000124566
AA Change: R319*
SMART Domains Protein: ENSMUSP00000115581
Gene: ENSMUSG00000030872
AA Change: R319*

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
VHS 29 162 2.45e-58 SMART
Pfam:GAT 225 326 1.3e-30 PFAM
Alpha_adaptinC2 471 595 8.68e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144779
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 94.2%
  • 20x: 86.6%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) family. This family includes ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. This family member may play a significant role in cargo molecules regulation and clathrin-coated vesicle assembly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality. Mice homozygous for a different gene trapped allele show decreased birth weight, hypoglycemia and partial neonatal lethality, with all remaining mice dying within the first three weeks of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030419C18Rik G T 9: 58,498,980 D58Y probably damaging Het
Abcc1 T C 16: 14,443,386 V676A probably damaging Het
Acvr1b T C 15: 101,193,938 L33P possibly damaging Het
Adamts12 T G 15: 11,256,894 probably benign Het
Ank1 T A 8: 23,111,803 probably benign Het
Arhgef10 T A 8: 14,940,225 D233E probably damaging Het
Cd209e T C 8: 3,849,084 *209W probably null Het
Cebpz A G 17: 78,923,313 V825A probably benign Het
Cep170 A G 1: 176,735,724 F1575L probably damaging Het
Exoc2 A T 13: 30,882,273 Y473* probably null Het
F3 A G 3: 121,729,374 T78A probably damaging Het
Fanca G A 8: 123,304,281 probably benign Het
Gid8 A G 2: 180,713,232 I10M probably benign Het
Glrb A G 3: 80,862,004 W139R probably damaging Het
H2-M1 A G 17: 36,671,167 S181P probably benign Het
Hectd3 G T 4: 116,997,170 V310L probably null Het
Kif17 C A 4: 138,277,994 S290* probably null Het
Kif26b A G 1: 178,916,463 N1375D probably damaging Het
Lgr4 C G 2: 109,991,135 P121A probably damaging Het
Ly75 A G 2: 60,293,758 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Nek3 T C 8: 22,160,361 probably benign Het
Nin A T 12: 70,043,929 L904Q probably damaging Het
Nlrp14 A G 7: 107,182,811 D405G probably benign Het
Nuak1 C T 10: 84,392,328 probably benign Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Plcg2 T A 8: 117,615,238 W1113R probably damaging Het
Pms2 G A 5: 143,925,913 V613M probably damaging Het
Prl3b1 G A 13: 27,243,865 A53T probably benign Het
Pxk T G 14: 8,150,915 probably null Het
Rasl10b G A 11: 83,417,839 probably null Het
Rbm28 A T 6: 29,137,640 I438N probably damaging Het
Rictor T C 15: 6,790,638 probably benign Het
Slc41a1 A G 1: 131,844,008 T387A probably benign Het
Slc44a2 T C 9: 21,343,026 V228A probably benign Het
Slpi A G 2: 164,354,867 probably benign Het
Tkfc A G 19: 10,593,474 S481P probably benign Het
Tll2 G A 19: 41,120,228 R328C probably damaging Het
Tns3 T C 11: 8,448,704 H1216R probably benign Het
Ugt2b38 A T 5: 87,424,114 S20T probably benign Het
Usp48 T A 4: 137,639,295 D921E possibly damaging Het
Usp48 T A 4: 137,644,463 S967T probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Zdhhc23 A G 16: 43,974,150 S54P probably benign Het
Other mutations in Gga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01519:Gga2 APN 7 122002188 missense probably damaging 1.00
IGL01577:Gga2 APN 7 121989783 missense probably damaging 1.00
IGL01584:Gga2 APN 7 121991538 missense probably benign
IGL01671:Gga2 APN 7 121994856 missense probably benign 0.01
IGL01680:Gga2 APN 7 121998076 missense probably benign 0.06
IGL02745:Gga2 APN 7 122008369 missense probably damaging 1.00
R0122:Gga2 UTSW 7 121991574 missense probably damaging 1.00
R0218:Gga2 UTSW 7 121998900 missense possibly damaging 0.46
R1774:Gga2 UTSW 7 122012221 missense probably damaging 0.98
R4127:Gga2 UTSW 7 122002720 missense probably damaging 1.00
R4510:Gga2 UTSW 7 122021078 missense unknown
R6319:Gga2 UTSW 7 122002166 missense possibly damaging 0.92
R6395:Gga2 UTSW 7 122008438 splice site probably null
R6486:Gga2 UTSW 7 122002188 missense probably damaging 1.00
R6952:Gga2 UTSW 7 121998888 missense probably benign 0.00
R7035:Gga2 UTSW 7 121989716 missense probably damaging 1.00
R7320:Gga2 UTSW 7 122002103 missense probably benign
R7454:Gga2 UTSW 7 122002146 missense probably benign 0.00
R7593:Gga2 UTSW 7 121990449 missense probably benign 0.00
R7602:Gga2 UTSW 7 121997330 missense probably benign 0.05
R7638:Gga2 UTSW 7 122003934 missense probably damaging 1.00
R7736:Gga2 UTSW 7 121990524 missense probably damaging 1.00
R8032:Gga2 UTSW 7 122020987 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACCCAAGAGGGGTTAAAACCTG -3'
(R):5'- CTGAATGTGCCAAGCCTGGTAGAG -3'

Sequencing Primer
(F):5'- GGGTTAAAACCTGGCACAAC -3'
(R):5'- CAGCGGAGATTCTTCAAGCA -3'
Posted On2014-02-11